ID: 1065112673

View in Genome Browser
Species Human (GRCh38)
Location 10:22455287-22455309
Sequence TTCTACTGGATGTGCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112661_1065112673 28 Left 1065112661 10:22455236-22455258 CCTTCTATGTAGCTAGAACTACA No data
Right 1065112673 10:22455287-22455309 TTCTACTGGATGTGCCGGCCAGG No data
1065112667_1065112673 -6 Left 1065112667 10:22455270-22455292 CCAACCTCAGCCCTGGGTTCTAC No data
Right 1065112673 10:22455287-22455309 TTCTACTGGATGTGCCGGCCAGG No data
1065112669_1065112673 -10 Left 1065112669 10:22455274-22455296 CCTCAGCCCTGGGTTCTACTGGA No data
Right 1065112673 10:22455287-22455309 TTCTACTGGATGTGCCGGCCAGG No data
1065112664_1065112673 0 Left 1065112664 10:22455264-22455286 CCACCACCAACCTCAGCCCTGGG No data
Right 1065112673 10:22455287-22455309 TTCTACTGGATGTGCCGGCCAGG No data
1065112666_1065112673 -3 Left 1065112666 10:22455267-22455289 CCACCAACCTCAGCCCTGGGTTC No data
Right 1065112673 10:22455287-22455309 TTCTACTGGATGTGCCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112673 Original CRISPR TTCTACTGGATGTGCCGGCC AGG Intergenic