ID: 1065112677

View in Genome Browser
Species Human (GRCh38)
Location 10:22455305-22455327
Sequence GCAGAAGTAGAGGTGGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112677_1065112685 7 Left 1065112677 10:22455305-22455327 CCAGGGGCCACCTCTACTTCTGC No data
Right 1065112685 10:22455335-22455357 TCCCAATGCTGGCCCTCCACAGG No data
1065112677_1065112688 10 Left 1065112677 10:22455305-22455327 CCAGGGGCCACCTCTACTTCTGC No data
Right 1065112688 10:22455338-22455360 CAATGCTGGCCCTCCACAGGTGG No data
1065112677_1065112689 17 Left 1065112677 10:22455305-22455327 CCAGGGGCCACCTCTACTTCTGC No data
Right 1065112689 10:22455345-22455367 GGCCCTCCACAGGTGGCCTCCGG No data
1065112677_1065112683 -4 Left 1065112677 10:22455305-22455327 CCAGGGGCCACCTCTACTTCTGC No data
Right 1065112683 10:22455324-22455346 CTGCTGGGGCCTCCCAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112677 Original CRISPR GCAGAAGTAGAGGTGGCCCC TGG (reversed) Intergenic