ID: 1065112679

View in Genome Browser
Species Human (GRCh38)
Location 10:22455309-22455331
Sequence GGGCCACCTCTACTTCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112670_1065112679 6 Left 1065112670 10:22455280-22455302 CCCTGGGTTCTACTGGATGTGCC No data
Right 1065112679 10:22455309-22455331 GGGCCACCTCTACTTCTGCTGGG No data
1065112667_1065112679 16 Left 1065112667 10:22455270-22455292 CCAACCTCAGCCCTGGGTTCTAC No data
Right 1065112679 10:22455309-22455331 GGGCCACCTCTACTTCTGCTGGG No data
1065112664_1065112679 22 Left 1065112664 10:22455264-22455286 CCACCACCAACCTCAGCCCTGGG No data
Right 1065112679 10:22455309-22455331 GGGCCACCTCTACTTCTGCTGGG No data
1065112669_1065112679 12 Left 1065112669 10:22455274-22455296 CCTCAGCCCTGGGTTCTACTGGA No data
Right 1065112679 10:22455309-22455331 GGGCCACCTCTACTTCTGCTGGG No data
1065112666_1065112679 19 Left 1065112666 10:22455267-22455289 CCACCAACCTCAGCCCTGGGTTC No data
Right 1065112679 10:22455309-22455331 GGGCCACCTCTACTTCTGCTGGG No data
1065112671_1065112679 5 Left 1065112671 10:22455281-22455303 CCTGGGTTCTACTGGATGTGCCG No data
Right 1065112679 10:22455309-22455331 GGGCCACCTCTACTTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112679 Original CRISPR GGGCCACCTCTACTTCTGCT GGG Intergenic