ID: 1065112681

View in Genome Browser
Species Human (GRCh38)
Location 10:22455312-22455334
Sequence GGCCCCAGCAGAAGTAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112681_1065112688 3 Left 1065112681 10:22455312-22455334 CCACCTCTACTTCTGCTGGGGCC No data
Right 1065112688 10:22455338-22455360 CAATGCTGGCCCTCCACAGGTGG No data
1065112681_1065112685 0 Left 1065112681 10:22455312-22455334 CCACCTCTACTTCTGCTGGGGCC No data
Right 1065112685 10:22455335-22455357 TCCCAATGCTGGCCCTCCACAGG No data
1065112681_1065112689 10 Left 1065112681 10:22455312-22455334 CCACCTCTACTTCTGCTGGGGCC No data
Right 1065112689 10:22455345-22455367 GGCCCTCCACAGGTGGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112681 Original CRISPR GGCCCCAGCAGAAGTAGAGG TGG (reversed) Intergenic
No off target data available for this crispr