ID: 1065112682

View in Genome Browser
Species Human (GRCh38)
Location 10:22455315-22455337
Sequence GGAGGCCCCAGCAGAAGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112682_1065112689 7 Left 1065112682 10:22455315-22455337 CCTCTACTTCTGCTGGGGCCTCC No data
Right 1065112689 10:22455345-22455367 GGCCCTCCACAGGTGGCCTCCGG No data
1065112682_1065112685 -3 Left 1065112682 10:22455315-22455337 CCTCTACTTCTGCTGGGGCCTCC No data
Right 1065112685 10:22455335-22455357 TCCCAATGCTGGCCCTCCACAGG No data
1065112682_1065112695 28 Left 1065112682 10:22455315-22455337 CCTCTACTTCTGCTGGGGCCTCC No data
Right 1065112695 10:22455366-22455388 GGAAACAACCCTCAGAAAGAAGG No data
1065112682_1065112688 0 Left 1065112682 10:22455315-22455337 CCTCTACTTCTGCTGGGGCCTCC No data
Right 1065112688 10:22455338-22455360 CAATGCTGGCCCTCCACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112682 Original CRISPR GGAGGCCCCAGCAGAAGTAG AGG (reversed) Intergenic