ID: 1065112683

View in Genome Browser
Species Human (GRCh38)
Location 10:22455324-22455346
Sequence CTGCTGGGGCCTCCCAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112671_1065112683 20 Left 1065112671 10:22455281-22455303 CCTGGGTTCTACTGGATGTGCCG No data
Right 1065112683 10:22455324-22455346 CTGCTGGGGCCTCCCAATGCTGG No data
1065112677_1065112683 -4 Left 1065112677 10:22455305-22455327 CCAGGGGCCACCTCTACTTCTGC No data
Right 1065112683 10:22455324-22455346 CTGCTGGGGCCTCCCAATGCTGG No data
1065112669_1065112683 27 Left 1065112669 10:22455274-22455296 CCTCAGCCCTGGGTTCTACTGGA No data
Right 1065112683 10:22455324-22455346 CTGCTGGGGCCTCCCAATGCTGG No data
1065112670_1065112683 21 Left 1065112670 10:22455280-22455302 CCCTGGGTTCTACTGGATGTGCC No data
Right 1065112683 10:22455324-22455346 CTGCTGGGGCCTCCCAATGCTGG No data
1065112676_1065112683 0 Left 1065112676 10:22455301-22455323 CCGGCCAGGGGCCACCTCTACTT No data
Right 1065112683 10:22455324-22455346 CTGCTGGGGCCTCCCAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112683 Original CRISPR CTGCTGGGGCCTCCCAATGC TGG Intergenic