ID: 1065112688

View in Genome Browser
Species Human (GRCh38)
Location 10:22455338-22455360
Sequence CAATGCTGGCCCTCCACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112682_1065112688 0 Left 1065112682 10:22455315-22455337 CCTCTACTTCTGCTGGGGCCTCC No data
Right 1065112688 10:22455338-22455360 CAATGCTGGCCCTCCACAGGTGG No data
1065112676_1065112688 14 Left 1065112676 10:22455301-22455323 CCGGCCAGGGGCCACCTCTACTT No data
Right 1065112688 10:22455338-22455360 CAATGCTGGCCCTCCACAGGTGG No data
1065112677_1065112688 10 Left 1065112677 10:22455305-22455327 CCAGGGGCCACCTCTACTTCTGC No data
Right 1065112688 10:22455338-22455360 CAATGCTGGCCCTCCACAGGTGG No data
1065112681_1065112688 3 Left 1065112681 10:22455312-22455334 CCACCTCTACTTCTGCTGGGGCC No data
Right 1065112688 10:22455338-22455360 CAATGCTGGCCCTCCACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112688 Original CRISPR CAATGCTGGCCCTCCACAGG TGG Intergenic