ID: 1065112695

View in Genome Browser
Species Human (GRCh38)
Location 10:22455366-22455388
Sequence GGAAACAACCCTCAGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112687_1065112695 6 Left 1065112687 10:22455337-22455359 CCAATGCTGGCCCTCCACAGGTG No data
Right 1065112695 10:22455366-22455388 GGAAACAACCCTCAGAAAGAAGG No data
1065112692_1065112695 -8 Left 1065112692 10:22455351-22455373 CCACAGGTGGCCTCCGGAAACAA No data
Right 1065112695 10:22455366-22455388 GGAAACAACCCTCAGAAAGAAGG No data
1065112686_1065112695 7 Left 1065112686 10:22455336-22455358 CCCAATGCTGGCCCTCCACAGGT No data
Right 1065112695 10:22455366-22455388 GGAAACAACCCTCAGAAAGAAGG No data
1065112690_1065112695 -4 Left 1065112690 10:22455347-22455369 CCCTCCACAGGTGGCCTCCGGAA No data
Right 1065112695 10:22455366-22455388 GGAAACAACCCTCAGAAAGAAGG No data
1065112682_1065112695 28 Left 1065112682 10:22455315-22455337 CCTCTACTTCTGCTGGGGCCTCC No data
Right 1065112695 10:22455366-22455388 GGAAACAACCCTCAGAAAGAAGG No data
1065112684_1065112695 10 Left 1065112684 10:22455333-22455355 CCTCCCAATGCTGGCCCTCCACA No data
Right 1065112695 10:22455366-22455388 GGAAACAACCCTCAGAAAGAAGG No data
1065112691_1065112695 -5 Left 1065112691 10:22455348-22455370 CCTCCACAGGTGGCCTCCGGAAA No data
Right 1065112695 10:22455366-22455388 GGAAACAACCCTCAGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112695 Original CRISPR GGAAACAACCCTCAGAAAGA AGG Intergenic