ID: 1065114921

View in Genome Browser
Species Human (GRCh38)
Location 10:22476143-22476165
Sequence GTCCGAACGCAGGGTTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065114921_1065114925 -5 Left 1065114921 10:22476143-22476165 CCAGTGAAACCCTGCGTTCGGAC No data
Right 1065114925 10:22476161-22476183 CGGACAGGAGAAGCTAACCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065114921 Original CRISPR GTCCGAACGCAGGGTTTCAC TGG (reversed) Intergenic
No off target data available for this crispr