ID: 1065114994

View in Genome Browser
Species Human (GRCh38)
Location 10:22476425-22476447
Sequence GCTCCCGGTGCCCGCGTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065114994_1065115009 14 Left 1065114994 10:22476425-22476447 CCAGCGACGCGGGCACCGGGAGC No data
Right 1065115009 10:22476462-22476484 CGGGCTTTGGCCCACACCCGGGG No data
1065114994_1065115014 27 Left 1065114994 10:22476425-22476447 CCAGCGACGCGGGCACCGGGAGC No data
Right 1065115014 10:22476475-22476497 ACACCCGGGGACCGCGGAGTGGG No data
1065114994_1065114997 -6 Left 1065114994 10:22476425-22476447 CCAGCGACGCGGGCACCGGGAGC No data
Right 1065114997 10:22476442-22476464 GGGAGCCCCTCCCGCCGGTCCGG No data
1065114994_1065115010 21 Left 1065114994 10:22476425-22476447 CCAGCGACGCGGGCACCGGGAGC No data
Right 1065115010 10:22476469-22476491 TGGCCCACACCCGGGGACCGCGG No data
1065114994_1065115008 13 Left 1065114994 10:22476425-22476447 CCAGCGACGCGGGCACCGGGAGC No data
Right 1065115008 10:22476461-22476483 CCGGGCTTTGGCCCACACCCGGG No data
1065114994_1065115006 12 Left 1065114994 10:22476425-22476447 CCAGCGACGCGGGCACCGGGAGC No data
Right 1065115006 10:22476460-22476482 TCCGGGCTTTGGCCCACACCCGG No data
1065114994_1065114998 -5 Left 1065114994 10:22476425-22476447 CCAGCGACGCGGGCACCGGGAGC No data
Right 1065114998 10:22476443-22476465 GGAGCCCCTCCCGCCGGTCCGGG No data
1065114994_1065115013 26 Left 1065114994 10:22476425-22476447 CCAGCGACGCGGGCACCGGGAGC No data
Right 1065115013 10:22476474-22476496 CACACCCGGGGACCGCGGAGTGG No data
1065114994_1065115002 1 Left 1065114994 10:22476425-22476447 CCAGCGACGCGGGCACCGGGAGC No data
Right 1065115002 10:22476449-22476471 CCTCCCGCCGGTCCGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065114994 Original CRISPR GCTCCCGGTGCCCGCGTCGC TGG (reversed) Intergenic