ID: 1065116586

View in Genome Browser
Species Human (GRCh38)
Location 10:22489053-22489075
Sequence CTTTCAGGCTGGATTCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065116586_1065116591 28 Left 1065116586 10:22489053-22489075 CCTCCAAGAATCCAGCCTGAAAG No data
Right 1065116591 10:22489104-22489126 GACCAAATAAGTGTTTTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065116586 Original CRISPR CTTTCAGGCTGGATTCTTGG AGG (reversed) Intergenic
No off target data available for this crispr