ID: 1065117674

View in Genome Browser
Species Human (GRCh38)
Location 10:22498236-22498258
Sequence CTCTATGTATGCAGGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065117670_1065117674 -10 Left 1065117670 10:22498223-22498245 CCATCCAAGACTACTCTATGTAT No data
Right 1065117674 10:22498236-22498258 CTCTATGTATGCAGGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065117674 Original CRISPR CTCTATGTATGCAGGTCAGA GGG Intergenic
No off target data available for this crispr