ID: 1065119359

View in Genome Browser
Species Human (GRCh38)
Location 10:22513883-22513905
Sequence AAAAGGCAGCAGTCCCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1871
Summary {0: 2, 1: 22, 2: 266, 3: 745, 4: 836}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065119359_1065119367 25 Left 1065119359 10:22513883-22513905 CCTAACTGGGACTGCTGCCTTTT 0: 2
1: 22
2: 266
3: 745
4: 836
Right 1065119367 10:22513931-22513953 GTGGAATGTAGAGAGGCAGTCGG No data
1065119359_1065119361 3 Left 1065119359 10:22513883-22513905 CCTAACTGGGACTGCTGCCTTTT 0: 2
1: 22
2: 266
3: 745
4: 836
Right 1065119361 10:22513909-22513931 CAGAGATGTCCTGCCCACAGAGG No data
1065119359_1065119362 6 Left 1065119359 10:22513883-22513905 CCTAACTGGGACTGCTGCCTTTT 0: 2
1: 22
2: 266
3: 745
4: 836
Right 1065119362 10:22513912-22513934 AGATGTCCTGCCCACAGAGGTGG No data
1065119359_1065119366 18 Left 1065119359 10:22513883-22513905 CCTAACTGGGACTGCTGCCTTTT 0: 2
1: 22
2: 266
3: 745
4: 836
Right 1065119366 10:22513924-22513946 CACAGAGGTGGAATGTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065119359 Original CRISPR AAAAGGCAGCAGTCCCAGTT AGG (reversed) Intergenic
902141553 1:14361091-14361113 GAAAGGCAGCAGCCCCAGTCGGG - Intergenic
903416230 1:23185104-23185126 AAAAGGCAGGAGGCCGAGTGCGG + Intergenic
903566882 1:24274408-24274430 GAAAGGCAGCACCCCCAGTCAGG - Intergenic
904059656 1:27698567-27698589 TAAAGGCAGCAGTCCCAAAGTGG - Intergenic
904599786 1:31667059-31667081 GTAAGGCTGCAGTCCCAGTTTGG + Intronic
906557888 1:46728824-46728846 AAAAGGCAGCAGCCCCAGTTAGG + Intergenic
906586804 1:46985347-46985369 AAAAGGCAGCAGCCCCAGTAAGG + Intergenic
906739922 1:48172878-48172900 GAAAGGCAGCAGCCCCTGTCAGG - Intergenic
906843058 1:49160708-49160730 AAGAGGCAGAAGCCCCAGTCAGG - Intronic
906890629 1:49709215-49709237 GAAAGGCAGCAGCCCCAGTCGGG - Intronic
906901098 1:49837214-49837236 GAAAGGCCGAAGTCCCAGTCAGG - Intronic
907015215 1:51005705-51005727 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
907953575 1:59206966-59206988 GAAAGGCAGAAGCCCCAGTCAGG + Intergenic
908316546 1:62938293-62938315 AAAATGCAGTAGTCCTTGTTTGG - Intergenic
908584590 1:65554371-65554393 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
908598246 1:65711204-65711226 GAAAGGCAGCAGCCCCAATCAGG - Intergenic
909337693 1:74494938-74494960 GCACAGCAGCAGTCCCAGTTAGG + Intronic
909403324 1:75258509-75258531 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
909415700 1:75403178-75403200 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
909493097 1:76247482-76247504 GAAATGCAGCAGCCCCAGTCAGG - Intronic
910148509 1:84112208-84112230 AAAAAGAAGCAGTCCAACTTAGG - Intronic
910177235 1:84443552-84443574 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
910331028 1:86072473-86072495 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
910604875 1:89072350-89072372 GAAAGGCAGTAGCCCCAGTCAGG + Intergenic
910626956 1:89317104-89317126 GTAAGGCAGCAGTCCCAGTCGGG + Intergenic
910635677 1:89405113-89405135 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
910670337 1:89766288-89766310 ATAAGGGAACAGTCACAGTTAGG - Intronic
910912558 1:92253251-92253273 GAAAGGCAGCAGCTCCAGTCAGG + Intronic
910940643 1:92530270-92530292 AAAACGCAGCAGCCCCAGTCAGG + Intronic
911217966 1:95216363-95216385 AAAAGGCAGCTGCCCCACTCAGG - Intronic
911541327 1:99161874-99161896 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
911632689 1:100200388-100200410 GAAAGGCAGCAGCACCAGTCAGG + Intronic
911648968 1:100365574-100365596 AAAAGGTTCCAGTCCCAATTTGG - Intronic
911692011 1:100845299-100845321 GAAAGGCAACAGGCCCAGTCAGG - Intergenic
911982782 1:104586858-104586880 GAAAGGGAGCAGCCCCAGTCAGG + Intergenic
912076693 1:105884343-105884365 AAAAGGAAGCAGCCTCAGTCAGG - Intergenic
912133327 1:106628393-106628415 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
912150553 1:106853733-106853755 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
912301365 1:108520402-108520424 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
912675828 1:111679871-111679893 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
912894840 1:113575848-113575870 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
912966277 1:114240059-114240081 GAAAAACAGCAGCCCCAGTTAGG + Intergenic
913108627 1:115639130-115639152 GAAAGGCAGCAGATCCAGTCAGG - Intergenic
914002742 1:143706200-143706222 AAAAGGCAGCACTGCCAGAGTGG - Intergenic
914458087 1:147855330-147855352 GAGAGGCAGCAGCCCCAGTCAGG + Intergenic
914967097 1:152269807-152269829 GAAAGGCAGCAGACCCAGTCAGG - Intergenic
914969270 1:152292310-152292332 GAAAGGCAGCAGACCCAGTCAGG + Intergenic
915061338 1:153188363-153188385 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
915077327 1:153319939-153319961 AAAAGGCAGCAGCCCCAGCCAGG - Intergenic
915649112 1:157294708-157294730 GAAAGGCAGCAGCCCCAGTAAGG + Intergenic
915654453 1:157347928-157347950 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
915758132 1:158282836-158282858 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
915868510 1:159532245-159532267 AAAAGGCAGAAGTGTTAGTTGGG - Intergenic
915876547 1:159616854-159616876 TAAAGACAGCAGCCCCAGTCAGG + Intergenic
915940017 1:160113198-160113220 CACAGTCAGCAGTACCAGTTTGG - Intergenic
915946135 1:160153054-160153076 AAAATGGAGCAGTCTCAGTTTGG + Intronic
916379702 1:164195917-164195939 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
916406312 1:164500960-164500982 GAAAGGCAGAAGCCCCAGTCAGG + Intergenic
916625565 1:166552077-166552099 GAAAGGCAGCAGCCCAAGTCAGG - Intergenic
916731565 1:167571574-167571596 AAAAGGCAGCAGCCCTAGTCAGG - Intergenic
916830402 1:168485313-168485335 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
916916127 1:169408378-169408400 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
916938583 1:169656746-169656768 GAAAGGCAGCAGCCTCAGTCGGG + Intergenic
917023341 1:170614185-170614207 GAAAGGCAGCAGCCCTAGTCAGG - Intergenic
917091769 1:171360017-171360039 GAAAAGCAGCAGCCCCAGTCAGG + Intergenic
917157233 1:172016713-172016735 AGAAGGCACCAGGCCCAGATGGG - Intronic
917157979 1:172025284-172025306 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
917163111 1:172080281-172080303 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
917274662 1:173319322-173319344 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
917312373 1:173690884-173690906 AAAAGGCAAAAATCCCAGTGGGG - Intergenic
917357791 1:174144352-174144374 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
917401340 1:174652955-174652977 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
917584945 1:176416827-176416849 AAAAGGCAGCAGCCCCATTTAGG - Intergenic
917900761 1:179540844-179540866 AAAAGGCAGCAGCCCAAGTCAGG - Intronic
917915246 1:179694832-179694854 GAAAGGCAGCAGCCCCAGCCAGG + Intergenic
918163397 1:181921216-181921238 GAAAGGCAGCAGCCACAGTCAGG + Intergenic
918167208 1:181961584-181961606 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
918195688 1:182219258-182219280 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
918360365 1:183751220-183751242 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
918612807 1:186512074-186512096 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
918632049 1:186730254-186730276 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
918906769 1:190506039-190506061 AAAAGGCAGCAGACCCAGTCAGG - Intergenic
919146743 1:193645053-193645075 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
919461630 1:197884177-197884199 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
919599028 1:199599949-199599971 GAAAGGCAGCAGCTCCAGTCAGG + Intergenic
920195850 1:204226580-204226602 AAAAGGCAGCAAAACCAGTCTGG - Intronic
920373020 1:205491686-205491708 CAAAAGCAGCAGGCCCAGGTGGG - Intergenic
920411176 1:205762130-205762152 TAAAGGCAGTAATCCCAGTCAGG - Intergenic
920428698 1:205899910-205899932 AAAAGGCAGCAGCCCTAGTCAGG + Intergenic
920873243 1:209811671-209811693 AATAGGCAGCATTCTCATTTAGG - Intergenic
920985620 1:210885876-210885898 GAGAGGCAGCAGCCCCAGTCAGG + Intronic
921401349 1:214727320-214727342 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
921461519 1:215432795-215432817 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
921484823 1:215703470-215703492 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
921626213 1:217380148-217380170 GAAAGGCAGCAGCCCCAGTAAGG + Intergenic
921631378 1:217437715-217437737 GAAATGCAGCAGCCCCAGTAAGG + Intronic
921640818 1:217551349-217551371 AAAAGGCATCAGTATCAATTGGG + Intronic
921943112 1:220863779-220863801 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
921962268 1:221047918-221047940 GAAAGGCAGCAGCCCCATTCAGG + Intergenic
921976363 1:221207379-221207401 GAAAGGCAGCATCCCCAGTCAGG + Intergenic
922379994 1:225013612-225013634 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
922396827 1:225210493-225210515 GAAAGGCAGCAGCCCAAGTCAGG + Intronic
922666572 1:227474380-227474402 GAAAGGCAGCAGTCCCAACCAGG + Intergenic
922691946 1:227700111-227700133 GAAAGGCAGCAGCCCCAGTGAGG + Intergenic
922716043 1:227872670-227872692 GAAAGGCAGCTGCCCCAGTCAGG + Intergenic
923046835 1:230361920-230361942 AAAAGCCATCAGCCCCAGTGGGG + Intronic
923061213 1:230476286-230476308 GAAAGCCAGCAGCCCCAGTTAGG - Intergenic
923066930 1:230526923-230526945 AAATGGCAGCAGCCCCAGTCAGG - Intergenic
923081373 1:230658710-230658732 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
923421763 1:233822770-233822792 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
923449409 1:234102653-234102675 CACAGGCAGCAGTCACAGCTTGG - Intronic
923690875 1:236191984-236192006 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
924179948 1:241430609-241430631 GAAAGACAGCAGCCCCAGTCAGG - Intergenic
924253359 1:242157967-242157989 AAAAGGCAACAGTCCCAGTCAGG - Intronic
924254617 1:242169915-242169937 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
924296052 1:242587432-242587454 AAATGGCAGCAGTCCCAGTTAGG + Intergenic
924493969 1:244568500-244568522 GAAAGGCAGCAGCCCCACTCAGG - Intronic
924782046 1:247158968-247158990 AAGAGGAAGCAGTCCCCCTTGGG - Intronic
924823080 1:247513167-247513189 GAAAGGCAACAGCCCCAGTCAGG - Intronic
924828977 1:247572828-247572850 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1063338032 10:5235269-5235291 CAGAGGCAGCAGCCCCAGTCAGG + Intergenic
1063976385 10:11420308-11420330 AAAAGGCACAAGGCCCAGATGGG + Intergenic
1064691573 10:17923906-17923928 AGAAGGAAGCAGAACCAGTTTGG + Intergenic
1065075969 10:22079947-22079969 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1065119359 10:22513883-22513905 AAAAGGCAGCAGTCCCAGTTAGG - Intergenic
1065120585 10:22526185-22526207 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1065120964 10:22530136-22530158 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1065427455 10:25619994-25620016 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1065621637 10:27587802-27587824 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
1065633670 10:27708871-27708893 AAAAAGCAGCAATACCGGTTGGG + Intronic
1066257612 10:33695942-33695964 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1066615447 10:37288934-37288956 GAAAGGCAGCAGCCCTAGTCAGG - Intronic
1066993460 10:42539371-42539393 AAAAGGCAGCATCCCCAGTCAGG - Intergenic
1067162136 10:43836223-43836245 GGAAGGCAGCAGTCACAGTCAGG - Intergenic
1067209659 10:44249573-44249595 GAAAGGCAGCAGCCGCAGTCTGG - Intergenic
1067236350 10:44453860-44453882 AAAAGGCAGCTGCCCCAGTCAGG - Intergenic
1067332238 10:45333282-45333304 AAAAGGCAGAAGCCCCAGTCAGG - Intergenic
1067579528 10:47433478-47433500 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1068086064 10:52374886-52374908 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1068357074 10:55923165-55923187 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1068469927 10:57448136-57448158 GAAAGGCAACAGCCCCAGTCAGG - Intergenic
1068575178 10:58676528-58676550 GAAAGGCAACAGCCCCAGTCAGG + Intronic
1068623037 10:59207904-59207926 AAAGGGCAGCAGCCCCAGTCAGG + Intronic
1068646227 10:59470900-59470922 AAAAGGCAGCAGCCCCAATTAGG + Intergenic
1068951606 10:62782788-62782810 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1069093442 10:64229606-64229628 GAAAGGCAGCAGCTCCAGTCAGG - Intergenic
1069120800 10:64567131-64567153 GAAAGACAGCAGCCCCAGTCAGG - Intergenic
1069139897 10:64810092-64810114 GAAAGACAGCAGCCCCAGTCAGG - Intergenic
1069348950 10:67502627-67502649 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1070234430 10:74608881-74608903 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1070349295 10:75576352-75576374 AAAAGGCAGTAGCCCCAGTCAGG + Intronic
1070632517 10:78096855-78096877 AAAAGGCAGTAGCCCCAGTCAGG + Intergenic
1071001988 10:80841408-80841430 GAAAGGCAGTAGCCCCAGTCAGG - Intergenic
1071190088 10:83089663-83089685 AAAAGGCAGCAGCCCCAATCAGG + Intergenic
1071272446 10:84020389-84020411 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1071341266 10:84651307-84651329 GAAAGGCAGCAGCCCCAGTGAGG - Intergenic
1071552801 10:86580183-86580205 AAAAGGCAGCAGGCCAGATTTGG - Intergenic
1071714039 10:88077143-88077165 AAAAGGCAGTGGTCCCTGGTTGG - Intergenic
1071844353 10:89506056-89506078 AAAAGGCAGCGGCCCCACTCAGG + Intronic
1072044920 10:91644645-91644667 GAAAGCCAGCAGCCCCAGTCAGG + Intergenic
1072358929 10:94640004-94640026 AAAAGGCAGCAGCCCCAGCCAGG - Intergenic
1072365323 10:94703391-94703413 TAAAGGCAGCAGCCCCAGTAGGG - Intronic
1072375657 10:94813438-94813460 GACAGGCAACAGTCCCAGTCAGG - Intronic
1072389527 10:94969085-94969107 GACAGGCAACAGTCCCAGTCAGG - Intronic
1072404438 10:95136665-95136687 ATAAGGCAGCAGTCGAAGTCAGG + Intergenic
1072493664 10:95934037-95934059 GAAAGGCAGTAGCCCCAGTCAGG - Intronic
1072662768 10:97372863-97372885 CAATGGCAGCAGTCCCAGAGCGG + Intronic
1072872327 10:99133220-99133242 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1072876213 10:99175603-99175625 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1073667106 10:105545957-105545979 AAAATGAAGCAGTCCTAGCTGGG - Intergenic
1073684120 10:105733916-105733938 AAAAGGAAGCAGTGACAGTGGGG + Intergenic
1073698162 10:105893911-105893933 GAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1073884218 10:108019678-108019700 GAAAGGCAGCAGCCCCAGTCTGG + Intergenic
1074015566 10:109530506-109530528 GAAAGGCAGCAGCCCCAGCCAGG + Intergenic
1074016727 10:109542229-109542251 AAAAGGTAGCAGCCCCAGTCAGG - Intergenic
1074648487 10:115491401-115491423 AAAAGGCAGCAGCCCAAGTCAGG - Intronic
1074795475 10:116938823-116938845 GAGAGGCAGCAGCCCCAGTCAGG - Intronic
1074821533 10:117183045-117183067 CAGAAGCAGCAGTTCCAGTTTGG + Intergenic
1074985140 10:118651932-118651954 GAAAGGCAGCAGCCCCCGTCAGG - Intergenic
1075145375 10:119878475-119878497 AAAAGGCAGCAAGTCCAGATTGG - Intronic
1075983885 10:126766703-126766725 GAAAGGAAGCAGCCCCAGTCAGG - Intergenic
1076389837 10:130090900-130090922 GAAAGGCAGCAGCGCCAGTCAGG + Intergenic
1077428276 11:2498345-2498367 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1077562014 11:3270070-3270092 AAAAGGCAGCAGCCCTAGTCAGG - Intergenic
1077567908 11:3315890-3315912 AAAAGGCAGCAGCCCTAGTCAGG - Intergenic
1077597614 11:3547478-3547500 ACAAGGCACCAGCCCAAGTTTGG + Intergenic
1077696467 11:4397352-4397374 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1078336385 11:10466523-10466545 AAAAGGCAGCAGCCCCAATCAGG + Intronic
1078392870 11:10951922-10951944 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1078686163 11:13534327-13534349 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1078732868 11:13992218-13992240 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1078743393 11:14089808-14089830 GAAAGGCGGCAGGCCCAGTCAGG - Intronic
1078809394 11:14743218-14743240 TAAAGGCAGCAGCCCCAGTCAGG - Intronic
1078814090 11:14801792-14801814 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1078998374 11:16728070-16728092 GAAAGGCAGCAGCCCCAGTGAGG + Intronic
1079262512 11:18897264-18897286 GAAAGGCAGCAGCCACAGTCAGG - Intergenic
1079316561 11:19412404-19412426 GAAAGGCAGCAACCCCAGTCAGG + Intronic
1079517899 11:21289974-21289996 GAAAGGAAGCAGCCCCAGTCAGG + Intronic
1079714935 11:23732382-23732404 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1079799754 11:24854278-24854300 GAAAGGCAGCAGCCTCAGTCAGG - Intronic
1079867939 11:25758775-25758797 GAAAGGGAGCCGCCCCAGTTAGG + Intergenic
1080033572 11:27688066-27688088 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1080117979 11:28641818-28641840 AAAAGGCAGGAGTCCCAGTCAGG + Intergenic
1080334572 11:31181197-31181219 GAAAGGCAGCAGCTCCAGTCAGG + Intronic
1080970799 11:37273959-37273981 AGAAAGCACCAGGCCCAGTTTGG - Intergenic
1080977183 11:37357054-37357076 GAAAGGCAGCTGCCCCAGTCAGG + Intergenic
1081080174 11:38731750-38731772 GAAAGGCCGCAGCCCCAGTCAGG - Intergenic
1081094930 11:38920994-38921016 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
1081166072 11:39810428-39810450 GAAATGCAGCAGTCCCAGTCAGG + Intergenic
1081198827 11:40192935-40192957 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1081221621 11:40469864-40469886 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1082127806 11:48453475-48453497 AAAAGGCAGCAGCCTCAGTCAGG - Intergenic
1082249619 11:49963945-49963967 AAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1082561355 11:54624404-54624426 AAAAGGCAGCAGCCTCAGTCAGG - Intergenic
1082670736 11:56033608-56033630 AAAAGGCAGCAGCCCCAGTTAGG + Intergenic
1082903578 11:58282969-58282991 GAAAGGCAGCAGACCCAGTGAGG - Intergenic
1082924411 11:58530534-58530556 AAAAGGCAGCAGCTCCAGTCAGG + Intronic
1083385492 11:62306313-62306335 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1083516190 11:63261472-63261494 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1084253713 11:67923384-67923406 ACAAGGCACCAGCCCAAGTTTGG + Intergenic
1084819165 11:71672542-71672564 ACAAGGCACCAGCCCAAGTTTGG - Intergenic
1084869619 11:72089196-72089218 CTAAGGCAGCAGGCCCAGTGTGG + Intronic
1084910929 11:72388575-72388597 AAAAGGCAGCAGCACCACTGTGG + Intronic
1085003408 11:73061791-73061813 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1085433890 11:76481729-76481751 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1085827684 11:79865192-79865214 AAACAGCAGCAGCCCCAGTCAGG + Intergenic
1085884488 11:80506059-80506081 AAAAGGTGGCAGCCCCAGTCAGG + Intergenic
1086086000 11:82956040-82956062 AAAAGGCAGCAGACCCACTCAGG - Intronic
1086129234 11:83383451-83383473 GAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1086300306 11:85420589-85420611 GAAAGGCAGCAGCCACAGTCAGG - Intronic
1086410743 11:86541629-86541651 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1086421944 11:86645532-86645554 AAAAGTCAGCAGCCCCAGTCAGG + Intronic
1086608477 11:88725367-88725389 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1086732793 11:90270720-90270742 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1086735624 11:90302300-90302322 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1086740494 11:90362243-90362265 AACTGGGGGCAGTCCCAGTTAGG - Intergenic
1086907288 11:92432892-92432914 GAAAGGCAGCAGCCCCAGTTAGG - Intronic
1087305792 11:96487621-96487643 AAAAGGCAGCATCCCCAGTCAGG + Intronic
1087326340 11:96727782-96727804 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1087410648 11:97786231-97786253 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1087568715 11:99896241-99896263 GAAAGGCAGCAAGCCCTGTTTGG - Intronic
1087667818 11:101070804-101070826 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1087695267 11:101369464-101369486 AAAAGGCAGTAGCCCCAATCAGG - Intergenic
1087703756 11:101466365-101466387 GAAAGGCAGTAGCCCCAGTCAGG - Intronic
1087712248 11:101567353-101567375 AAAAAGCAGCAGCCCTAGTCAGG + Intronic
1087830943 11:102819553-102819575 GAAAGGCAGAAGCCCCAGTCAGG - Intergenic
1087925178 11:103911066-103911088 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1088034598 11:105296409-105296431 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1088066490 11:105726374-105726396 GAAAGGCAGAAGCCCCAGTCAGG + Intronic
1088294442 11:108277023-108277045 GACAGGCAGCAGCCCCAGTCAGG - Intronic
1089285441 11:117404811-117404833 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1089882423 11:121787469-121787491 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1090312726 11:125756392-125756414 GAAAGGCAGCAGCCCCAGTTAGG + Intergenic
1090688899 11:129156559-129156581 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1090725073 11:129517763-129517785 GAAAGGCAGCAGCCCTAGTCAGG - Intergenic
1090811718 11:130250246-130250268 GAAAGACAGCAGCCCCAGTCAGG + Intronic
1090928451 11:131273407-131273429 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1091089997 11:132762469-132762491 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1091306725 11:134541132-134541154 ACAAGGCAGCACTGCCAGTGAGG + Intergenic
1091417143 12:298027-298049 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1091712203 12:2750005-2750027 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1091958787 12:4672712-4672734 AAAAGGCAGTAGCCCAAGTCAGG + Intronic
1092003567 12:5050482-5050504 CATAGGCAGAATTCCCAGTTTGG - Intergenic
1092304397 12:7284036-7284058 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1092332182 12:7594695-7594717 AAAACGCAGCAGCCCCAGTCAGG + Intergenic
1092423786 12:8356771-8356793 ACAAGGCACCAGCCCAAGTTTGG + Intergenic
1092440432 12:8496389-8496411 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1092567659 12:9685497-9685519 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1092581647 12:9849246-9849268 AAATGGCAGCAGCCCCAGTTAGG - Intergenic
1092628928 12:10358184-10358206 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1092638922 12:10482148-10482170 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1092690932 12:11109151-11109173 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1093333242 12:17868881-17868903 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1093402328 12:18761402-18761424 GAAAGGCAGCAGCCCCAGTTAGG + Intergenic
1093530860 12:20161256-20161278 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1093545015 12:20336269-20336291 TAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1093664434 12:21795207-21795229 GAAAGGCAGCAGCTCCAGTCAGG - Intergenic
1093714527 12:22366420-22366442 GTAAGGCAGCAGCCCCAGTCAGG + Intronic
1093835570 12:23824745-23824767 GAAAGGCAGCAGGCCCAGCGAGG - Intronic
1094061051 12:26315968-26315990 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1094140000 12:27171532-27171554 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1094453333 12:30604640-30604662 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1094656986 12:32429678-32429700 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1094729993 12:33163763-33163785 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1094733079 12:33200512-33200534 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1094755438 12:33463199-33463221 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1094757890 12:33493052-33493074 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1094782031 12:33802490-33802512 GAAATGCAGCAGCCCCAGTCAGG - Intergenic
1095128348 12:38508483-38508505 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1095149340 12:38772608-38772630 AAAAGGAAGCAGTGTCAGTGAGG + Intronic
1095247837 12:39943412-39943434 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1095286135 12:40412799-40412821 GGAAGGAAGCAGTCCCAGTGAGG + Intronic
1095356455 12:41280695-41280717 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1095406375 12:41871012-41871034 GAAAGGCAGTAGCCCCAGTCAGG + Intergenic
1095491637 12:42740618-42740640 ATAATTCAGCAGTCCCATTTTGG + Intergenic
1095694896 12:45133022-45133044 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1095706703 12:45244659-45244681 AAAACGCAGCAGTGTCAGCTAGG - Intronic
1095778903 12:46037363-46037385 GAAACGCAGCAGCCCCAGTCAGG + Intergenic
1095831444 12:46591338-46591360 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1095920603 12:47526243-47526265 GAAAGGCAACAGTCCCAGTCAGG - Intergenic
1095930963 12:47624636-47624658 GAAAGGCAGCAGTCCGAGTCAGG + Intergenic
1096751535 12:53761881-53761903 AGGAGGCAGCAGACCCAGGTGGG - Intergenic
1096892468 12:54785868-54785890 CAGTGGCAGCAGTCCCAGGTGGG + Intergenic
1096941878 12:55355710-55355732 AAAAGACAGCAAGCCCAGTTAGG + Intergenic
1097339944 12:58426347-58426369 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1097372507 12:58801495-58801517 AAAAGGCAGCAGGCTAAGTATGG - Intronic
1097375782 12:58841045-58841067 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1097412156 12:59268389-59268411 GAAAGGCAGCAGACCCAGTCAGG + Intergenic
1097435531 12:59549047-59549069 AAAAGGCAGCAGCCACAGTCAGG - Intergenic
1097488471 12:60235154-60235176 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1097619544 12:61923077-61923099 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1097635164 12:62113650-62113672 GAAAGGCAGCAGTCCCAGTCAGG - Intronic
1097654397 12:62343074-62343096 AAAATGCAGCAGCCCCAGCCAGG - Intronic
1097763320 12:63493789-63493811 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1097898770 12:64853147-64853169 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1098052966 12:66473309-66473331 GAAAGGCACCAGCCCCAGTCAGG + Intronic
1098151837 12:67555367-67555389 AAAAGGCAGCAGCACCAGTCAGG - Intergenic
1098183154 12:67869531-67869553 AAAAGGTAGCAGCCCCATTCAGG - Intergenic
1098438755 12:70496878-70496900 AAAAGGCAGCAGTCCCAGTCAGG - Intergenic
1098704631 12:73671881-73671903 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1098780196 12:74676866-74676888 CAAAGGCAGCAGCTCCAGTCAGG + Intergenic
1098906619 12:76169515-76169537 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1099030863 12:77524266-77524288 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1099053432 12:77808833-77808855 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1099071332 12:78048876-78048898 GAAAGGTAGCAGCCCCAGTCAGG - Intronic
1099107927 12:78519402-78519424 GAAAGGCGGCAGTCCCAGTCAGG + Intergenic
1099236072 12:80083931-80083953 GAAAGACAGCAGCCCCAGTCAGG - Intergenic
1099238895 12:80115706-80115728 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1099435236 12:82634818-82634840 AAAAGGTAGCAGCCACAGTCAGG - Intergenic
1099492071 12:83300230-83300252 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1099527760 12:83736386-83736408 GAAATGCAGCAGCCCCAGTCAGG - Intergenic
1099554812 12:84097910-84097932 TAAAGGCAGCAGCCCCAATCAGG + Intergenic
1099697450 12:86040390-86040412 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1099699146 12:86061856-86061878 AAAAGGCAGCAGCCTCAGTCAGG + Intronic
1099897576 12:88667938-88667960 GAAAGGCAGCAGCCCCAGTAAGG + Intergenic
1099943927 12:89222657-89222679 GAAAGGCTGCAGTCCCAGTCAGG - Intergenic
1100073901 12:90755142-90755164 AAAAGGCAGAAGCCCCAGTCAGG - Intergenic
1100111083 12:91243034-91243056 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1100136304 12:91557264-91557286 GAAAGGCAGAAGCCCCAGTCAGG + Intergenic
1100434643 12:94560673-94560695 AAGAGGCAGGAGGCCCAGGTGGG + Intergenic
1100740076 12:97581865-97581887 GAAAGACAGCAGCCCCAGTCAGG + Intergenic
1100798033 12:98202467-98202489 GAATGGCAGCAGACCCAGTCAGG + Intergenic
1100799846 12:98219655-98219677 TGAAGGCAGCTGTCTCAGTTTGG - Intergenic
1100896297 12:99186221-99186243 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1100996236 12:100303917-100303939 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1101069825 12:101062542-101062564 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1101206561 12:102494042-102494064 GAAAGGCAGAAGCCCCAGTCAGG - Intergenic
1101595824 12:106163660-106163682 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1101601211 12:106212049-106212071 AGAAGGCAGCAGCCCCAGTCAGG - Intergenic
1103169125 12:118798801-118798823 GAAAAGCAGCAGCCCCAGTCAGG - Intergenic
1103255617 12:119539348-119539370 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1103583407 12:121933438-121933460 AAATGGCAGCACTCCCTGCTGGG - Intronic
1104115570 12:125746202-125746224 GAAAGGCAGCAGCCCCATTCAGG - Intergenic
1105316497 13:19270287-19270309 GAAAGGCAGCAGCCCCAGTGAGG + Intergenic
1105355142 13:19652912-19652934 AAAAGGCGGCAGCCACAGTCAGG + Intronic
1105552443 13:21410517-21410539 GAAAGGCAGCAGCCTCAGTCAGG - Intronic
1105645764 13:22316105-22316127 CAAAGGCAGCAGCCCCAGTTAGG - Intergenic
1105737352 13:23285265-23285287 GAAAGGCAGTAGCCCCAGTCAGG - Intronic
1105769445 13:23594596-23594618 GAAAGGCAGCAGCCCCAGTGAGG + Intronic
1106025840 13:25954339-25954361 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1106042174 13:26103736-26103758 GAAAGGCAGTAGCCCCAGTCAGG + Intergenic
1106156787 13:27166424-27166446 AAAAGGAGGCAGACTCAGTTTGG + Intronic
1106326312 13:28693717-28693739 AAAAGACAGCAGCCCCAGTCAGG - Intergenic
1106335050 13:28776541-28776563 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1106335991 13:28783838-28783860 AAAAGGCAGCAGCCCCAGTGAGG - Intergenic
1106336559 13:28788862-28788884 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1106361862 13:29038700-29038722 GAAAGGCAGCAGCCCCAGTAAGG - Intronic
1106377405 13:29203169-29203191 GAAAGGCAGCAGCCACAGTCAGG - Intronic
1106378776 13:29216036-29216058 GAAAGGCGGCAGCCCCAGTCAGG - Intronic
1106426556 13:29636316-29636338 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1106584661 13:31046605-31046627 ATAAGGCAGCAGTATCAGTGTGG - Intergenic
1106650890 13:31688725-31688747 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1106874205 13:34054427-34054449 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1106983831 13:35321754-35321776 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1107289793 13:38839613-38839635 GAAAGGCTGCAGCCCCAGTCAGG - Intronic
1107473429 13:40712525-40712547 GAAAGGCAGCAGCCCCGGTAAGG - Intergenic
1107551442 13:41479963-41479985 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1107641930 13:42452827-42452849 GAAAGCCAGCAGGCCCAGTCAGG - Intergenic
1107648199 13:42516769-42516791 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
1107968810 13:45622038-45622060 GAAAGGCGGCAGCCCCAGTCAGG - Intergenic
1107970821 13:45640835-45640857 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1108030050 13:46220264-46220286 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1108048781 13:46408750-46408772 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1108217725 13:48201360-48201382 AAAAAGCAGCAGCCCCAGTCAGG + Intergenic
1108235083 13:48394728-48394750 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1108236866 13:48416899-48416921 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1108262770 13:48675299-48675321 GAAAGGCAGAAGCCCCTGTTAGG - Intronic
1108599895 13:51983397-51983419 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1108609603 13:52071209-52071231 AAAAGGGAGGGGTCCCAGGTTGG + Intronic
1108674008 13:52720959-52720981 GAAAGGCAGCAGCCCCAGTCGGG - Intronic
1108678867 13:52762418-52762440 AAAAGGCAGCAATTCCCATTTGG + Intergenic
1108858264 13:54822287-54822309 GAAAGGCAGCAGCCCAAGTCAGG + Intergenic
1109163411 13:59003928-59003950 GCAAGGCAGCAGCCCCAGTCAGG - Intergenic
1109187931 13:59292181-59292203 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1109457468 13:62611409-62611431 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1109541311 13:63782095-63782117 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1109559799 13:64031949-64031971 AAAAGGCAACAGTCCAAATGTGG + Intergenic
1109615448 13:64828500-64828522 ACAAGGCAGCAGCCCCAGTCAGG + Intergenic
1109626605 13:64982677-64982699 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1109731587 13:66420155-66420177 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1109791252 13:67250841-67250863 AGAACACAGTAGTCCCAGTTGGG - Intergenic
1109902772 13:68795535-68795557 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1110019980 13:70457787-70457809 GAAAAGCAGCAGCCCCAGTCAGG + Intergenic
1110389739 13:74959940-74959962 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1110824720 13:79958604-79958626 GAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1110890318 13:80690076-80690098 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1110942061 13:81363024-81363046 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1111114244 13:83754911-83754933 GAAAGGCAGCAGCCCCAGTTAGG + Intergenic
1111635104 13:90893143-90893165 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1112151953 13:96773659-96773681 GAAAGGCAGCATCCCCAGTCAGG + Intronic
1112165880 13:96919199-96919221 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
1112231642 13:97593701-97593723 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1112546486 13:100376507-100376529 GAAAGGCAGCAGCCCCACTCAGG - Intronic
1112620123 13:101046605-101046627 GAAAGGCAGCAGCCCCAGCCAGG - Intergenic
1112759643 13:102679908-102679930 AACAGGCAGCAGTCCAGTTTGGG - Intronic
1113131487 13:107042275-107042297 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1113976783 13:114233563-114233585 AAAAGGCAGAAGTTACAGCTGGG + Intergenic
1114163382 14:20193533-20193555 AATAGGCAGCAGGCCAGGTTTGG - Intergenic
1114341971 14:21754559-21754581 AAAAAGCAGCAGCCCCAGTCAGG + Intergenic
1114433823 14:22686491-22686513 AAAAGGTAGCAGCCCCAGTCAGG + Intergenic
1114695449 14:24623375-24623397 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1114710096 14:24768931-24768953 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1114741781 14:25105046-25105068 AAAAGGCAGCAGCTCCAGTCAGG + Intergenic
1114745015 14:25137204-25137226 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1114784929 14:25585716-25585738 AAAATGCAGCAGCCCCAGTCGGG - Intergenic
1114844919 14:26309395-26309417 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1114870086 14:26645463-26645485 GAAAGGCAGCAGCCTCAGTCAGG - Intergenic
1115048669 14:29029036-29029058 GAAAGGCAGCAGTCCCAGTTAGG - Intergenic
1115162314 14:30410107-30410129 GAAAGGCAGCATCCCCAGTCAGG - Intergenic
1115265408 14:31494893-31494915 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1115277031 14:31620940-31620962 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1115281472 14:31668217-31668239 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1115359778 14:32488186-32488208 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1115538081 14:34392001-34392023 GAAAGGCAGCAACCCCAGTCAGG + Intronic
1115690996 14:35843844-35843866 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1115842709 14:37490108-37490130 AAAAGGCAGCAGCACCAGTCAGG - Intronic
1115867194 14:37760674-37760696 GAAAGGCAGCAGTCCCAGTTAGG - Intronic
1115912123 14:38268612-38268634 GAAAGGCAGCAGCCCCAGGCAGG - Intergenic
1115940303 14:38601474-38601496 GAAAGGCAGCAGTTCCAGTGAGG - Intergenic
1115974376 14:38980849-38980871 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1116227549 14:42171385-42171407 GAAAGGCAGCAGCCCCAATCAGG + Intergenic
1116366353 14:44070270-44070292 ATAAGCTAGCAGTCCCACTTGGG - Intergenic
1116433597 14:44873469-44873491 AAAAGGCAGCAGCCCTAGTCAGG - Intergenic
1116511855 14:45756256-45756278 GAAAGGCAGCAGCCGCAGTCAGG - Intergenic
1116565443 14:46438969-46438991 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1116572409 14:46534765-46534787 GAAAGGCAGCAGCCCCAGTTAGG - Intergenic
1116743893 14:48792949-48792971 AAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1116771434 14:49131430-49131452 GAAAGGTAGCAGCCCCAGTAGGG - Intergenic
1116775753 14:49178959-49178981 GAAAAGCAGCAGCCCCAGTCAGG + Intergenic
1117069315 14:52042353-52042375 AAAAGACAGCAAATCCAGTTAGG + Intronic
1117104301 14:52382634-52382656 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1117121095 14:52568776-52568798 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1117299219 14:54407502-54407524 GAAAGGCAGCAGTTCCAGTCAGG - Intronic
1117399857 14:55349034-55349056 AAAGATCTGCAGTCCCAGTTTGG - Intronic
1117466488 14:55999718-55999740 GAAAGGCAGCAGCCCCACTCAGG - Intergenic
1117600031 14:57365396-57365418 GAAAGGCAGCAGGCCCAGTCAGG + Intergenic
1117617043 14:57544727-57544749 AAAAGGCAGCGGCCTCAGTCAGG - Intergenic
1117624263 14:57619023-57619045 AAAAGGCGGCAGCTCCAGTCAGG + Intronic
1117655499 14:57951767-57951789 GAAAGGCAGCAGCCCCACTCAGG + Intronic
1117710729 14:58526042-58526064 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1117821889 14:59658232-59658254 GAAAGACAGCAGCCCCAGTCAGG + Intronic
1117930514 14:60836897-60836919 GAAAGGCAGCAGCCCCAGTAAGG - Intronic
1118647187 14:67851473-67851495 AGAAGGCAGCAGTCCTGGTTGGG + Intronic
1119960346 14:78848667-78848689 AAACTGCAGCAGGCCCAGTTGGG + Intronic
1120271754 14:82321745-82321767 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1120565298 14:86047994-86048016 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1120770148 14:88370351-88370373 AAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1120804290 14:88729380-88729402 AATAGGCAGCAGGCCTGGTTTGG - Intronic
1120843128 14:89104481-89104503 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1121312438 14:92942501-92942523 AGAAGGAAGCAGACTCAGTTGGG - Intronic
1121899023 14:97675112-97675134 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1123480856 15:20629572-20629594 AAAAGGCAACTGTCCTAGTCAGG + Intergenic
1123637156 15:22370793-22370815 AAAAGGCAACTGTCCCAGTCAGG - Intergenic
1124084233 15:26531840-26531862 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1124474644 15:30022547-30022569 GAAAGGCAGCAGCCCCAGCCAGG - Intergenic
1124666742 15:31598988-31599010 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1125288547 15:38120205-38120227 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1125329974 15:38573225-38573247 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1125354518 15:38803129-38803151 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1125784330 15:42301836-42301858 GAAAGGCAGCAGCCCCAATCGGG + Intronic
1125808734 15:42518006-42518028 AAAAGAAAGAAGTGCCAGTTGGG - Intronic
1125984759 15:44039154-44039176 AAAAGGCAACAGCCTCAGTCAGG + Intronic
1126050860 15:44683572-44683594 GAAAGGCAGTAGCCCCAGTCAGG + Intronic
1126500512 15:49339782-49339804 AAAAGGCACCAGCCCCAATCAGG - Intronic
1126554116 15:49966600-49966622 GAAAGGCAGCGGCCCCAGTCAGG + Intronic
1126862746 15:52902868-52902890 AAAAGGCAGCAGCCCTAGCCAGG + Intergenic
1126952168 15:53893512-53893534 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1127317844 15:57814743-57814765 AAAAGGCAGCAGTCCCAGTCAGG - Intergenic
1127452556 15:59131195-59131217 ATACGGCAGCAGCCCCAGTCAGG - Intergenic
1128838603 15:70831532-70831554 CAAAGTCAGCACTCCCAGTTGGG + Exonic
1129495552 15:75976987-75977009 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1129499123 15:76018986-76019008 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1129507930 15:76098738-76098760 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1129563237 15:76593303-76593325 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1129952745 15:79606515-79606537 AATAGGCAGCAGGCCCATTTTGG - Intergenic
1130724059 15:86419946-86419968 GAAAGGCAGCAGCTCCAGTCAGG + Intronic
1132096450 15:98988473-98988495 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1133374491 16:5273169-5273191 ACAAGGCACCAGCCCAAGTTTGG - Intergenic
1133881412 16:9786074-9786096 CAAAGGCAGAAATCACAGTTGGG - Intronic
1134166681 16:11935778-11935800 GAAAGGTAGCTGGCCCAGTTTGG + Intronic
1134494022 16:14717927-14717949 GAAAGGTAGCTGGCCCAGTTTGG - Intronic
1134499402 16:14757051-14757073 GAAAGGTAGCTGGCCCAGTTTGG - Intronic
1134525953 16:14943678-14943700 GAAAGGTAGCTGGCCCAGTTTGG - Intronic
1134546454 16:15112684-15112706 GAAAGGTAGCTGGCCCAGTTTGG + Intronic
1134581170 16:15371968-15371990 GAAAGGTAGCTGGCCCAGTTTGG + Intronic
1134713532 16:16342166-16342188 GAAAGGTAGCTGGCCCAGTTTGG - Intergenic
1134721402 16:16385524-16385546 GAAAGGTAGCTGGCCCAGTTTGG - Intronic
1134946024 16:18326360-18326382 GAAAGGTAGCTGGCCCAGTTTGG + Intronic
1134953287 16:18366504-18366526 GAAAGGTAGCTGGCCCAGTTTGG + Intergenic
1135312073 16:21413193-21413215 GAAAGGTAGCTGGCCCAGTTTGG + Intronic
1135365022 16:21845649-21845671 GAAAGGTAGCTGGCCCAGTTTGG + Intronic
1135446818 16:22525690-22525712 GAAAGGTAGCTGGCCCAGTTTGG - Intronic
1135807584 16:25556623-25556645 GAAAGTCAGCAGCCCCAGTCAGG + Intergenic
1136151246 16:28351119-28351141 GAAAGGTAGCTGGCCCAGTTTGG + Intronic
1136167478 16:28464959-28464981 GAAAGGTAGCTGGCCCAGTTTGG + Intronic
1136195499 16:28650059-28650081 GAAAGGTAGCTGGCCCAGTTTGG - Intronic
1136211837 16:28764175-28764197 GAAAGGTAGCTGGCCCAGTTTGG - Intronic
1136256557 16:29044121-29044143 GAAAGGTAGCTGGCCCAGTTTGG - Intronic
1136288187 16:29256289-29256311 AAAAGTCTGCAGTCCCAGGGAGG - Intergenic
1136308778 16:29392184-29392206 GAAAGGTAGCTGGCCCAGTTTGG + Intronic
1136322193 16:29493715-29493737 GAAAGGTAGCTGGCCCAGTTTGG + Intronic
1136436872 16:30233687-30233709 GAAAGGTAGCTGGCCCAGTTTGG + Intronic
1137268122 16:46885008-46885030 AAACCGCAGCAGCCCCAGCTGGG + Intronic
1137296351 16:47097505-47097527 GAAAGGCAGCAGTCCCAGTCAGG + Intronic
1137336447 16:47554174-47554196 AAAAGGCAGCAGCCACAGTCAGG - Intronic
1137658019 16:50177348-50177370 AAAAGGCACCAGGCCCAGATGGG - Intronic
1137828130 16:51517257-51517279 AAAAGGCAGTAGCCCCAGTCGGG + Intergenic
1138151581 16:54662143-54662165 AAGAGGCAGCAGCCCCAGTCAGG + Intergenic
1138592217 16:58007330-58007352 AGAAGGCACCAGGCCCAGATGGG - Intronic
1138843619 16:60538933-60538955 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1138886944 16:61091252-61091274 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1139856483 16:69984619-69984641 GAAAGGTAGCTGGCCCAGTTTGG + Intergenic
1140165272 16:72543986-72544008 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1140257742 16:73351284-73351306 ATTAGGCAGCAGGCCCAGTGCGG - Intergenic
1140281755 16:73561118-73561140 AAAATGCAGAACACCCAGTTAGG - Intergenic
1140366248 16:74383444-74383466 GAAAGGTAGCTGGCCCAGTTTGG - Intronic
1140885683 16:79240524-79240546 AAAGGGCAGCAGCCCCAGTTAGG + Intergenic
1141246081 16:82309070-82309092 GAAAGGCAGCAGCCTCAGTCAGG - Intergenic
1143427110 17:6848850-6848872 GAAAGGCAGCAGCTCCAGTCAGG - Intergenic
1144012570 17:11163689-11163711 AAAAGGTAACAGCCCCAGTCAGG + Intergenic
1144242234 17:13323846-13323868 CAGAGGCAGCAGTACCACTTGGG - Intergenic
1144434095 17:15223759-15223781 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1144449230 17:15361781-15361803 AAAGGGGAGCAGTCTCAGCTAGG + Intergenic
1146655804 17:34634505-34634527 AAGAGGCAGCAGTTGCTGTTAGG + Intronic
1146742868 17:35301631-35301653 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1146746301 17:35333585-35333607 GAAAGGCAGCAGCTCCAGTCAGG - Intergenic
1146825905 17:36023194-36023216 AAAAGGCAGCAGCCACAGTCAGG - Intergenic
1147525294 17:41216650-41216672 GAAAGGCAGCAGCCCCATTCAGG + Intronic
1147692893 17:42328693-42328715 AAAATGTAGCAGTCCTAGCTGGG - Intronic
1147747759 17:42705836-42705858 TAAAGGCTTCAGTCCCAGTAGGG - Intronic
1148691873 17:49533102-49533124 AGAAGGCACCAGCCCCAGATGGG - Intergenic
1148967418 17:51447470-51447492 GAAATGCAGCAGCCCCAGTCAGG + Intergenic
1149093836 17:52817060-52817082 AAAAGACAGCAGCCCCAGTCAGG - Intergenic
1149222915 17:54436331-54436353 AAATGGCAGCAGCCCCAGTCAGG + Intergenic
1149281242 17:55108077-55108099 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1149365491 17:55939459-55939481 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
1149786900 17:59443331-59443353 AACAGGCAGCAGTCCAAATTTGG + Intergenic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1150545807 17:66155865-66155887 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1150884651 17:69071073-69071095 GAAAGGCAGCAGCCCCAATCAGG + Intergenic
1151064157 17:71131651-71131673 GAAAGGCAGCAACCCCAGTCAGG - Intergenic
1151135216 17:71940111-71940133 AAAAGGCATTGGTCCAAGTTAGG + Intergenic
1151251892 17:72842651-72842673 AAAAGGCTGCAGTCTCGGGTTGG + Intronic
1153059349 18:979752-979774 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1153313385 18:3699795-3699817 GAAACGCAGCAGCCCCAGTCAGG - Intronic
1153482722 18:5563699-5563721 AAATGGCACCACCCCCAGTTGGG - Intronic
1153702650 18:7711815-7711837 AAAAGGCAGCAGACCCAGTCAGG + Intronic
1153717824 18:7868856-7868878 GAAAGGCAGCGGTCCCAGGCAGG - Intronic
1153798495 18:8647208-8647230 GAAAAGCAGCAGCCCCAGTCAGG + Intergenic
1154117957 18:11627882-11627904 GAAAGGTAGCTGGCCCAGTTTGG + Intergenic
1154382205 18:13862898-13862920 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1155006716 18:21735858-21735880 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1155047317 18:22114132-22114154 AAGAGGCAGCTGTCCCAGTGGGG - Intergenic
1155080561 18:22406311-22406333 AACAGGCAGCAACCCCAGTTAGG + Intergenic
1155487669 18:26363902-26363924 AAAAGGGAGCACTCTCAGTTGGG + Intronic
1155665154 18:28299183-28299205 AAAAGGTAGCAGCCCCAGTCAGG - Intergenic
1155857310 18:30849930-30849952 AGAAGGTAGCAGCCCCAGTCAGG - Intergenic
1156626841 18:38919912-38919934 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1156979249 18:43265463-43265485 AAAAGGCAGCAGCCCCCGTCAGG - Intergenic
1157068116 18:44375300-44375322 GAAAGACAGCAGCCCCAGTCAGG + Intergenic
1157071781 18:44416702-44416724 TAAAGGCAGGAGCCCCAGTCAGG + Intergenic
1157695077 18:49716121-49716143 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1157901739 18:51524594-51524616 AACAGACAGCAGGCCCAATTTGG - Intergenic
1158073029 18:53495938-53495960 AAAAAGCAGCAGCCCCAGTCAGG + Intronic
1158098662 18:53804636-53804658 GAAAGGCAGCAGCTCCAGTCAGG + Intergenic
1158116233 18:53999094-53999116 AAAAGACAACAGTCCCCATTTGG + Intergenic
1158558859 18:58497090-58497112 AAGAAGCAGCAGGGCCAGTTGGG - Intronic
1158853409 18:61518102-61518124 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1159254754 18:65931420-65931442 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1159385938 18:67725692-67725714 GAAAGGCAGCATTCCCAGTCAGG - Intergenic
1159562225 18:70007739-70007761 GAAAGGCAGCAGGCCCAGTCAGG + Intronic
1159581362 18:70237200-70237222 TAAAGGCAGCAGCTCCAGTCAGG + Intergenic
1159645771 18:70916415-70916437 GAAAGGCAGCAGCCACAGTCAGG - Intergenic
1159690567 18:71482665-71482687 GAAAGGGAGCAGCCCCAGTCAGG - Intergenic
1159901798 18:74053734-74053756 GAAAGGCAGCAGCCCCAATCAGG + Intergenic
1160175133 18:76587487-76587509 ACAGGCCAGCAGCCCCAGTTAGG + Intergenic
1160466620 18:79083063-79083085 GAAAGGCAGCTGCCCCAGTCAGG - Intronic
1162865124 19:13540150-13540172 AAAACGCAGCAGGCCCAGGAAGG + Intronic
1163817724 19:19477123-19477145 CAAAGGCAGCAGATCCAGCTTGG - Intronic
1164112773 19:22184849-22184871 AAAAGGCAGCAGCCACAGTCGGG + Intronic
1164730025 19:30496620-30496642 GAAAGGCAGCAGAGGCAGTTGGG + Intronic
1165254563 19:34567873-34567895 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1166215013 19:41329146-41329168 AAATGGCAGCAGCCACAGGTGGG - Intronic
1167627249 19:50599870-50599892 AAAAGGAAGGGGTCCCAGGTTGG - Intergenic
1167711013 19:51110935-51110957 AACAGGCAGCAGGCCCGATTTGG + Intergenic
1167974080 19:53209960-53209982 AAAAGGCAGCAGCCCCAATCAGG - Intergenic
1168523068 19:57068012-57068034 GAAAGGCGCCAGCCCCAGTTAGG + Intergenic
1168530827 19:57127440-57127462 AAAGGGTAACAGTCCCAGTCAGG - Intronic
924967651 2:92771-92793 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
925252423 2:2451351-2451373 GAAAGGCAACAGTCCCAGTCAGG - Intergenic
925566347 2:5258349-5258371 GAAAGGCAGCAACCCCAGTTAGG - Intergenic
925692377 2:6538164-6538186 GAAAGCCAGCAGCCCCAGTCAGG + Intergenic
926508621 2:13745656-13745678 AAAAGACAGCAGCTCCAGTCAGG + Intergenic
926970621 2:18463865-18463887 CAAAGGCAGCAGCCCCAGTCAGG - Intergenic
927117193 2:19916709-19916731 AAAAGCCAGCAGCCCCAGTCAGG + Intronic
927182820 2:20459088-20459110 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
928750682 2:34466994-34467016 GAAAGGGAGCAGCCCCAGTCGGG + Intergenic
928830575 2:35478053-35478075 ATAAGGCATCAGCCCCAGTCAGG + Intergenic
929064714 2:37962350-37962372 GAAAGGCAGCAGCACCAGTCAGG - Intronic
929257712 2:39830635-39830657 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
929333509 2:40712591-40712613 GAAAGGCAGCAGCCCCGGTCAGG - Intergenic
929838046 2:45426332-45426354 GAAAGGCAGCAGGCCCAGTCAGG + Intronic
930216977 2:48707552-48707574 CAAAGGCAGCAGCCACAGTCAGG - Intronic
930264698 2:49186155-49186177 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
930323367 2:49882668-49882690 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
930359358 2:50358563-50358585 AAAAGACAGCAGCCCCAGTCAGG + Intronic
930439925 2:51391989-51392011 GAAAGGCAGCAGCCTCAGTCAGG + Intergenic
930476625 2:51891044-51891066 AGAAGGCAGCAGCCCCATTCAGG - Intergenic
930516097 2:52409805-52409827 AAAAGGCAGCAGCCCCAGTTCGG - Intergenic
930860318 2:56065208-56065230 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
931004122 2:57828436-57828458 AAAAGTCAGCAGCCCCAGTCAGG + Intergenic
931073990 2:58688973-58688995 GAAAGGCAGCAGCCCCAGGCAGG + Intergenic
931134073 2:59377092-59377114 AAAAGGCTAATGTCCCAGTTTGG - Intergenic
931134224 2:59378156-59378178 CAATGGCAGCAGTCCCAGACAGG - Intergenic
931480421 2:62633768-62633790 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
931538701 2:63305078-63305100 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
931566470 2:63620505-63620527 GAAAGGCAGCAGCCCCCGTCAGG + Intronic
931814864 2:65890435-65890457 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
931886673 2:66625639-66625661 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
931907573 2:66858915-66858937 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
932051840 2:68405677-68405699 GAAAGGTAGCAGCCCCAGTCAGG + Intergenic
932368372 2:71167345-71167367 TTAAGGCAGCAGTTCCAGCTAGG - Intergenic
932429293 2:71664383-71664405 AACAGGCTGCTGTCCAAGTTTGG + Exonic
932523403 2:72437556-72437578 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
932646760 2:73510872-73510894 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
932899536 2:75681926-75681948 AAAAGCCAGCAGCCCCAGTCAGG + Intronic
932938925 2:76139370-76139392 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
933084900 2:78044040-78044062 AGAAGGAAGCAGTAACAGTTGGG + Intergenic
933166603 2:79083415-79083437 GAAAGGCAGCAGCCTCAGTCAGG - Intergenic
933355678 2:81206552-81206574 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
933413168 2:81950862-81950884 GAAAGGCAGCAGCTCCAGTCAGG - Intergenic
933438510 2:82279685-82279707 AAAATGTATCAGTTCCAGTTAGG - Intergenic
933488254 2:82950227-82950249 GAAAGGCAGCAGCCCCAGCTGGG - Intergenic
933603210 2:84354423-84354445 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
934698875 2:96422601-96422623 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
934702768 2:96455180-96455202 GAAAGGCAGCAGTGCCAGTCAGG + Intergenic
934871848 2:97873231-97873253 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
935010916 2:99135240-99135262 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
935325867 2:101936143-101936165 AAAAAGCAGCAGCCCCAGTCAGG + Intergenic
935353507 2:102176973-102176995 AAAAGGCAGTAGGCCCGGTGTGG + Exonic
935567924 2:104629358-104629380 GAAAGCCAGCAGCCCCAGTCCGG - Intergenic
935961521 2:108429927-108429949 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
935980819 2:108625130-108625152 AAAAGGCAGCAGGCCAGATTTGG - Intronic
935982854 2:108644000-108644022 AAAAGGCAGCAACCCCAGTCAGG + Intronic
936375495 2:111937609-111937631 AACAGGCATCAGCCCCAGTAAGG - Intronic
936999942 2:118456939-118456961 GAAAGGCAACAGCCCCAGTCAGG - Intergenic
937143165 2:119619069-119619091 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
937464989 2:122124793-122124815 AAGAGGCAGCAGTCTCAGTCAGG - Intergenic
937573548 2:123392157-123392179 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
937807313 2:126161255-126161277 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
937872009 2:126792715-126792737 AAAATGCAGCAGACTCAGTGGGG - Intergenic
937893337 2:126957080-126957102 GAAAGGCAGCAGCCCCAATCAGG + Intergenic
938144771 2:128824171-128824193 GAAAGGCAGCAACCCCAGTCAGG + Intergenic
938221191 2:129569316-129569338 GAAAGGCAGCAGCTCCAGTCAGG + Intergenic
938952286 2:136266407-136266429 GAAAGGCAGCAGCCCCAATCAGG - Intergenic
939033301 2:137101872-137101894 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
939116873 2:138070998-138071020 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
939180414 2:138796421-138796443 GAAAGGCAGCAACCCCAGTCAGG + Intergenic
939382011 2:141448073-141448095 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
939470695 2:142616169-142616191 GAAAGACAGCAGCCCCAGTCAGG + Intergenic
939504922 2:143033448-143033470 AGAAGGCAGCATTCCCCTTTAGG + Intronic
939652839 2:144785760-144785782 GAAAGGCAGCAGCCCCAATCCGG + Intergenic
939687115 2:145213482-145213504 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
939739671 2:145890247-145890269 AAAATTCAGCAGATCCAGTTTGG + Intergenic
939840641 2:147182991-147183013 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
939937741 2:148313310-148313332 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
939942031 2:148362468-148362490 GAAAGGCAGCATCCCCAGTCAGG + Intronic
939946953 2:148421914-148421936 GAAAGGCAGTAGCCCCAGTCAGG + Intronic
940030522 2:149257306-149257328 AAAAAGCAGCAGCCCCAGTCAGG - Intergenic
940400737 2:153245101-153245123 GAAATGCAGCAGCCCCAGTCAGG + Intergenic
940408059 2:153328461-153328483 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
940565129 2:155351200-155351222 GAAAGGTAGCAGCCCCAGTCAGG - Intergenic
940593979 2:155766753-155766775 AAAAGGTAGCAGCCCCAGTCAGG - Intergenic
940602633 2:155880691-155880713 GAAAGGCAGCAACCCCAGTCGGG + Intergenic
940612335 2:156006947-156006969 AGCAGGCAGCAGTCCAAGCTGGG - Intergenic
940925201 2:159356472-159356494 GAAAGACAGCAGCCCCAGTCAGG + Intronic
940946532 2:159624177-159624199 AGAAGGCAGCAGCCCCAGTCAGG + Intergenic
940964559 2:159822516-159822538 AAAGGGCAGCAGCCACAGTCAGG + Intronic
940999048 2:160181470-160181492 GAAAGGCAGTAGCCCCAGTCAGG + Intronic
941076419 2:161010785-161010807 AAAAGGCAGCAACCCCAGTCAGG + Intergenic
941114981 2:161462058-161462080 GAAAGGCATCAGCCCCAGTCAGG - Intronic
941119621 2:161513657-161513679 GAAAGGCATCAGCCCCAGTCAGG + Intronic
941239365 2:163017280-163017302 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
941276613 2:163498167-163498189 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
941478077 2:165972257-165972279 GAAAGGCAGCAGCCTCAGTCAGG + Intergenic
941518687 2:166511240-166511262 AAAAGGCAGCAGCACCAGTCAGG - Intergenic
941565321 2:167099163-167099185 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
941571482 2:167175796-167175818 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
941682302 2:168412700-168412722 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
941845323 2:170126386-170126408 AAAAGGCAGCAGCGCCAGTCAGG + Intergenic
941920788 2:170848846-170848868 AAAAAGCAGCAGTTCCTGCTGGG - Intronic
942199930 2:173560397-173560419 GAAAGACAGCAGCCCCAGTCAGG + Intergenic
942431265 2:175913958-175913980 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
942576953 2:177373861-177373883 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
942722259 2:178966099-178966121 AAAAGGCAGCCGCCCCAGTCAGG + Intronic
942732624 2:179076386-179076408 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
942898784 2:181089699-181089721 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
942953656 2:181750196-181750218 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
943074616 2:183179197-183179219 GAAAGCCAGCAGCCCCAGTCAGG - Intergenic
943084965 2:183300461-183300483 AAAAGGCAGCAGCCCCAGACAGG - Intergenic
943094912 2:183417083-183417105 GAAAGTCAGCAGTTTCAGTTGGG + Intergenic
943129990 2:183842361-183842383 GAAAGGAAGCAGCCCCAGTCAGG + Intergenic
943350746 2:186793486-186793508 AAAAGGCAGCAGCTCCAGTCAGG + Intergenic
943352550 2:186812564-186812586 AAAAGGCACCAGCACCAGTCAGG + Intergenic
943408730 2:187519804-187519826 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
943512340 2:188841102-188841124 GAAAAGCAGCAGACCCAGTCAGG + Intergenic
943552456 2:189357392-189357414 AAAAGGCAGTAGCCCCAGTCAGG - Intergenic
943660518 2:190554639-190554661 AAAAGGCAACAGTCCCAGTCAGG + Intergenic
943826357 2:192398565-192398587 AAAAGGAAGCAGTCCCGGACAGG + Intergenic
943836855 2:192524956-192524978 GAAAGGCAGCGGCCCCAGTCAGG + Intergenic
944094780 2:195953593-195953615 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
944267934 2:197748717-197748739 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
944292066 2:198018713-198018735 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
944347423 2:198685284-198685306 AAAAGGCAGCATCCCCAGTCAGG + Intergenic
944421600 2:199536826-199536848 AAAAGGCGGCAGCCCCAGTCAGG + Intergenic
944764386 2:202849612-202849634 GAAAGGCAGCAGCCCCAGCCAGG + Intronic
945207257 2:207344939-207344961 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
945329696 2:208525186-208525208 GAAAGGCAGCAGCCCCCGTCAGG - Intronic
945405795 2:209447327-209447349 AAAGGGCAGCAGTTCAAGGTAGG - Intronic
945409206 2:209488770-209488792 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
945409821 2:209495167-209495189 GAAAGGCAGCAGCCCTAGTCAGG + Intronic
945482171 2:210357359-210357381 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
945486864 2:210406852-210406874 AAAGGGCAGCAGCCCCAGTCAGG - Intergenic
945490184 2:210445942-210445964 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
945533739 2:210986868-210986890 AACAGGCAGCATCCCCAGTCAGG - Intergenic
945666746 2:212753249-212753271 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
945945228 2:215988875-215988897 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
946065285 2:216982362-216982384 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
946204269 2:218092159-218092181 AAAGGGCAGCAGTCCCTTTCTGG + Intergenic
947086077 2:226454425-226454447 GAAAGGCAGAAGCCCCAGTCAGG + Intergenic
947225817 2:227839345-227839367 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
947642740 2:231716076-231716098 TCAGGGCAGCAGTCCCAGTGAGG - Intergenic
947681388 2:232037194-232037216 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
948102142 2:235383716-235383738 AAAGGGCAGAATTCCCAGTTGGG + Intergenic
1168922018 20:1546277-1546299 GAAAGACAGCAGCCCCAGTCAGG - Intronic
1168938820 20:1691357-1691379 GAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1169176668 20:3522397-3522419 GAAAGGCAGCATCCCCAGTCAGG + Intronic
1169197479 20:3691364-3691386 CAGAGGCAGCAGCCCCAGTGGGG + Exonic
1169320020 20:4624981-4625003 GAAAGGTAGCAGCCCCAGTCAGG - Intergenic
1169397017 20:5241377-5241399 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1169605899 20:7319117-7319139 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1169646237 20:7812817-7812839 GAAACGCAGCAGCCCCAGTCAGG - Intergenic
1170092949 20:12612523-12612545 AAGAGGCAGCAGGCCAGGTTTGG - Intergenic
1170133941 20:13052875-13052897 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1170167863 20:13380734-13380756 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1170229359 20:14028071-14028093 GAAAGGCATCAGCCCCAGTCAGG - Intronic
1170266351 20:14470581-14470603 AAAAAGCAGCAGCCCCAGTCAGG - Intronic
1170294269 20:14806923-14806945 TAAAGGCAGCAGCCCCAGCCAGG + Intronic
1170454633 20:16520511-16520533 GAAAGGCAGTAGCCCCAGTCAGG + Intronic
1170727305 20:18941507-18941529 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1171000882 20:21414317-21414339 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1171441423 20:25166430-25166452 GAAAGGCAGTAGCCCCAGTCAGG + Intergenic
1171513365 20:25706360-25706382 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1172466863 20:35161758-35161780 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1173223424 20:41147191-41147213 AAAAGGCCACAGTCCCAGTTAGG - Intronic
1173510991 20:43628273-43628295 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1173751130 20:45477818-45477840 AAAAGGCAGCAGCCCTAGTCAGG - Intronic
1174016925 20:47496210-47496232 CAAGGGCAGCTGTGCCAGTTAGG - Intergenic
1174937889 20:54892520-54892542 AACAGGCAGCAGACCTAATTCGG - Intergenic
1174990116 20:55500216-55500238 AAAAGGCAGCAGCCCCAGTTAGG - Intergenic
1175040981 20:56050363-56050385 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1176272182 20:64241148-64241170 TAAAGGCTGCAGCCCCAGTAGGG - Exonic
1176891816 21:14327647-14327669 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1177042672 21:16132851-16132873 GAAAGGCAGCAGCCCCAATCAGG - Intergenic
1177050307 21:16225085-16225107 GAAAGGCAGCAGCCACAGTCAGG + Intergenic
1177129695 21:17240953-17240975 GAAAGGCACCAGCCCCTGTTAGG + Intergenic
1177136407 21:17309099-17309121 GAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1177184161 21:17775400-17775422 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1177313266 21:19424648-19424670 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1178007140 21:28234525-28234547 GAAAGGGAGCAGCCCCAGTCAGG + Intergenic
1178393596 21:32219958-32219980 GAAAGGTAGCAGCCCCAGTCAGG + Intergenic
1178864415 21:36316331-36316353 GAAAGGCAGCAACCCCAGTCAGG - Intergenic
1180596268 22:16975492-16975514 AAAAGGCTACAGTCCGAGTCAGG + Intronic
1180976001 22:19848803-19848825 AGAAGGCAGCAATCCCAGGCTGG + Exonic
1182870342 22:33640898-33640920 GAAAGGCAGCAGCTCCAGTCAGG + Intronic
1183021464 22:35030601-35030623 GAAAGGCAGCAGCTCCAGTCGGG - Intergenic
1183182682 22:36271557-36271579 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
949227008 3:1706167-1706189 AAAAGGCAACAGCCCCAGTCAGG + Intergenic
949246412 3:1930068-1930090 AAACGGCAGCAGCCCCAGTCAGG + Intergenic
949377690 3:3408052-3408074 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
949423498 3:3891280-3891302 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
949440177 3:4071777-4071799 AAAAGGCAGCAGCCTCTGTCAGG + Intronic
949453345 3:4211912-4211934 AAAAGGCAGCAACCCCAGTCAGG + Intronic
949580576 3:5383933-5383955 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
949583396 3:5413002-5413024 AAAAAGCAGCAGCCTCAGTCAGG + Intergenic
949594560 3:5530634-5530656 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
949640412 3:6029962-6029984 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
949641009 3:6036045-6036067 GAAAGGCAGCAGCTCCAGTCAGG - Intergenic
949683380 3:6541146-6541168 AAAAGGCAGCAGCCCCTGTCAGG - Intergenic
949846125 3:8372382-8372404 AAAAGGCAGCAGCCCGAGTCAGG + Intergenic
950597423 3:13996938-13996960 GAAAGGCAGTAGCCCCAGTCAGG - Intronic
950619648 3:14194349-14194371 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
950752831 3:15144407-15144429 ACAAGGCACCAGCCCAAGTTTGG - Intergenic
950924942 3:16731165-16731187 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
950992056 3:17449714-17449736 GAAAGGCAGGAGCCCCAGTTAGG + Intronic
951055850 3:18145566-18145588 AACAGGCAGCAGGCCCCGTTTGG - Intronic
951198151 3:19847044-19847066 GAAAGGCAGCAGCCCGAGTCAGG - Intergenic
951254464 3:20432783-20432805 GAAAGGCAGCAGCCTCAGTCAGG - Intergenic
951277135 3:20701604-20701626 AAAAGGCATCAGTCCAGTTTTGG - Intergenic
951310943 3:21125339-21125361 GAAAGGCAGCAGCCCCAGTGAGG + Intergenic
951324437 3:21285395-21285417 GAAAGGCAGCAGGCCCAGTCAGG - Intergenic
951347196 3:21560803-21560825 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
951434232 3:22643260-22643282 AAAAGGCAGCAACCCCAGTAAGG - Intergenic
951503639 3:23417713-23417735 GAAAGGCAGCAGCCCTAGTCAGG - Intronic
951629089 3:24699124-24699146 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
951676409 3:25246979-25247001 GAAAGGCAGCAGCCCTAGTCAGG - Intronic
951687568 3:25362146-25362168 GAAAGGCAGCAGCCCCAGACAGG - Intronic
951741708 3:25931952-25931974 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
951777219 3:26323730-26323752 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
951795456 3:26533655-26533677 GAAAGGCAGCAGCCCCACTCAGG - Intergenic
951826702 3:26876327-26876349 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
951974123 3:28484396-28484418 AAAAAGCAGCAAGCCCAGATGGG - Intronic
952098586 3:29985055-29985077 GAAAGGCAGCAGCCCCAGTTAGG - Intronic
953047269 3:39305008-39305030 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
953102317 3:39842115-39842137 GAAAGGCAGCAGCCCCAGTTAGG - Intronic
953264314 3:41371127-41371149 GAAAGGCAGCAGCTCCAGTCAGG + Intronic
953315891 3:41925831-41925853 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
953433383 3:42858005-42858027 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
953555754 3:43945738-43945760 GAAGGGCAGCAGCCCCAGTCAGG - Intergenic
953636362 3:44668496-44668518 CAAAGCCAGTAGTCCCAGTCAGG + Intergenic
953675245 3:44996054-44996076 CAAAGCCAGCAGTTCCAGTGAGG - Intronic
954157690 3:48695656-48695678 AAAAGGCAGAGGTCCCACTACGG + Intronic
954490591 3:50901133-50901155 GAAAGGCAGCAGCCCCATTCAGG - Intronic
954507674 3:51092494-51092516 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
954510470 3:51120623-51120645 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
954524977 3:51261896-51261918 GAAAGACAGCAGGCCCAGTCAGG + Intronic
954531112 3:51320808-51320830 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
954574803 3:51670141-51670163 AAAAGTCAGCAGTCACAGGGTGG - Intronic
954940711 3:54369672-54369694 AAAAGGCAGATGTCCCAGGTGGG - Intronic
954950562 3:54468908-54468930 GAAAGGCAGCAGCCCCGGTTAGG + Intronic
954978661 3:54723052-54723074 AAAAGGCAGCAGCCTCAGTCAGG - Intronic
955175074 3:56605929-56605951 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
955414266 3:58678259-58678281 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
955439784 3:58943057-58943079 GAAAGGCAGCAGCTCCAGTCAGG + Intronic
955447839 3:59032680-59032702 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
955521852 3:59783046-59783068 AAGAGGCAGCAGCCCCAGACTGG - Intronic
956005845 3:64777270-64777292 GAAAGACAGCAGCCCCAGTCAGG + Intergenic
956157302 3:66312150-66312172 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
956207689 3:66771480-66771502 GAAAGGCAGCAGCTCCAGTCAGG - Intergenic
956212067 3:66812302-66812324 AACAGGCAGCAGGCCAAGTTTGG + Intergenic
956220124 3:66893509-66893531 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
956242099 3:67142074-67142096 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
956243442 3:67154753-67154775 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
956279391 3:67540529-67540551 GCAAGGCAGCAGCCCCAGTCAGG + Intronic
956301871 3:67781255-67781277 AAAAGGCAGCAGTACCAGCCAGG - Intergenic
956383034 3:68686112-68686134 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
956398090 3:68847175-68847197 GAAAGGCAGCAGACCAAGTCAGG - Intronic
956505372 3:69932436-69932458 TACAGGCAGCAGACCGAGTTGGG + Intronic
957067782 3:75539856-75539878 ACAAGGCACCAGCCCAAGTTTGG + Intergenic
957256583 3:77845034-77845056 GAAAGGCAGCAGCCCTAGTCAGG - Intergenic
957474870 3:80709914-80709936 GAAAGGCAGTAGCCCCAGTCAGG + Intergenic
957489514 3:80905824-80905846 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
957695750 3:83636196-83636218 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
957776526 3:84761493-84761515 GAAAGGCAGTAGCCCCAGTCAGG + Intergenic
957811560 3:85228976-85228998 AAAAGGCAGCAGACCCAGTCAGG - Intronic
957930914 3:86876826-86876848 GAAAGGCGGCAGCCCCAGTCAGG - Intergenic
958257433 3:91341056-91341078 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
958261234 3:91383409-91383431 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
958434492 3:94080566-94080588 AAAAGGCAGCAGCTTCAGTAAGG - Intronic
958476164 3:94585767-94585789 GAAAGGCAGCAGCTCCAGTCAGG - Intergenic
958520884 3:95184411-95184433 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
958586277 3:96091674-96091696 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
958622189 3:96575928-96575950 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
958694537 3:97510846-97510868 GAAAGGAAGCAGTCCCAGTCAGG - Intronic
958793614 3:98682354-98682376 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
959025682 3:101237199-101237221 GAATGGCAGCAGCCCCAGTCAGG + Intronic
959074577 3:101736178-101736200 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
959091780 3:101911112-101911134 AAAAGGCAGCAGCCCCTGTCAGG - Intergenic
959093044 3:101924701-101924723 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
959120079 3:102222751-102222773 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
959278244 3:104304782-104304804 AAAAGGCAGCATCTCCAGTTGGG + Intergenic
959291922 3:104485435-104485457 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
959453794 3:106534530-106534552 GAAAGGAAGCAGCCCCAGTCAGG + Intergenic
959534642 3:107470844-107470866 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
959735004 3:109648380-109648402 GAAAGGCAGAAGCCCCAGTCAGG + Intergenic
959747560 3:109795240-109795262 GAAAGGCAGCAGCCCCAGTAAGG + Intergenic
959801030 3:110495500-110495522 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
959815839 3:110672040-110672062 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
959842896 3:110999085-110999107 AAGAGGCAGCATCCCCAGTCAGG + Intergenic
959848112 3:111057141-111057163 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
959875719 3:111380018-111380040 GAAAGGCAGCAGCCTCAGTCAGG + Intronic
959881169 3:111446764-111446786 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
960075996 3:113485560-113485582 AAAAAGCAGCAGCCCCAGTCAGG + Intronic
960226886 3:115179272-115179294 GAAACGCAGCAGCCCCAGTCAGG - Intergenic
960378094 3:116927953-116927975 GGAAGGCAGCAGCCCCAGTCAGG - Intronic
960491608 3:118322270-118322292 GAAAGGCAGCAGCCCCTGTCAGG - Intergenic
960579865 3:119267650-119267672 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
960634614 3:119770881-119770903 CCAAGGATGCAGTCCCAGTTGGG + Intergenic
960760062 3:121063649-121063671 GAAAGGCAGCAGCCCCAGTCTGG - Intronic
960763285 3:121097002-121097024 AAAAGGCAGCAGCCCCCATAAGG - Intronic
960768666 3:121167663-121167685 ATAAGACAGCAGCCCCAGTCAGG + Intronic
960773119 3:121216840-121216862 GACAGGCAGCAGCCCCAGTCAGG - Intronic
961218395 3:125180075-125180097 AAAAGGCAGCATTTACAGCTTGG - Intronic
961285374 3:125798124-125798146 ACAAGGCACCAGCCCAAGTTTGG - Intergenic
961310621 3:125997059-125997081 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
961977548 3:131042593-131042615 GAAAGGCAGCAGCCTCAGTTAGG + Intronic
961998218 3:131268925-131268947 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
962124861 3:132606612-132606634 GAAAGGCAGTAGCCCCAGTCAGG + Intronic
962156893 3:132957203-132957225 GAAAGACAGCAGCCCCAGTCAGG + Intergenic
962471421 3:135712522-135712544 ACAAGGAAGTGGTCCCAGTTCGG - Intergenic
962634748 3:137319244-137319266 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
962666073 3:137654679-137654701 AAAAGACAGCAGCCCCAGTCAGG + Intergenic
962668426 3:137679826-137679848 AACAGGCAGCAGCCCCAGTCAGG + Intergenic
962765743 3:138560852-138560874 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
963013934 3:140802944-140802966 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
963027476 3:140933871-140933893 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
963306480 3:143659226-143659248 AAAAAGCAGCAGCCATAGTTAGG + Intronic
963401709 3:144806665-144806687 GAAATGCAGCAGCCCCAGTCAGG - Intergenic
963629266 3:147712818-147712840 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
963898697 3:150712625-150712647 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
963976348 3:151484283-151484305 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
964010402 3:151885624-151885646 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
964046306 3:152331614-152331636 AAAAGGAAGCGGACCCAGTAAGG + Intronic
964049452 3:152372956-152372978 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
964264187 3:154875454-154875476 AAAAGGCAGCAGCCCTAGTCAGG + Intergenic
964332618 3:155620743-155620765 AAAAGGCAGTAGCCCCAGTCAGG + Intronic
964371338 3:156003746-156003768 AAAAGTTAGCAGCCCCAGTCAGG - Intergenic
964377998 3:156068819-156068841 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
964391221 3:156200478-156200500 GAAAGGCACCAGCCCCAGTCAGG - Intronic
964543350 3:157804186-157804208 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
964649056 3:158991229-158991251 AAAAGGCTGCAGCCCCAGTCAGG - Intronic
964904869 3:161707558-161707580 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
965293153 3:166909551-166909573 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
965324646 3:167288832-167288854 CAAAGGCAGCAGTGCCATGTTGG - Intronic
965497297 3:169413869-169413891 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
965511138 3:169568701-169568723 TAAAAGCAGCAGCCCCAGTCAGG + Intronic
965621913 3:170650818-170650840 GAAATGCAGCAGCCCCAGTCAGG - Intronic
965655012 3:170974921-170974943 AAAAGGCAGCAGCCCCCATCAGG - Intergenic
965801265 3:172496571-172496593 GAAAGGCAGCAGCCCCAGTAAGG - Intergenic
966251102 3:177866185-177866207 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
966255080 3:177908339-177908361 GAAAGGCAGCAGCCCCAATCAGG - Intergenic
966255169 3:177908950-177908972 GGAAGGCAGCAGCCCCAGTCAGG + Intergenic
966291231 3:178361589-178361611 GAAAGGCAGCAGCCCCAGCCAGG + Intergenic
966309447 3:178576825-178576847 GAAAGGCAGCAGCCCCAGACAGG + Intronic
966533268 3:181004164-181004186 GAAAGGCAGCAGCCCCATTCAGG - Intergenic
966561423 3:181324895-181324917 GAAAGGCAGCAGCACCAGTCAGG - Intergenic
966637884 3:182156364-182156386 GAAAGGCAGCAGCTCCAGTAGGG - Intergenic
967155720 3:186690180-186690202 AAAAGGCAGCTGGTCCAGTGAGG - Intergenic
967157009 3:186702345-186702367 AAAAGGCAGCTGGTCCAGTGAGG - Intergenic
967181465 3:186909194-186909216 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
967419537 3:189258661-189258683 GAAAGGCAGCAGCCCCAATCAGG - Intronic
967638638 3:191834930-191834952 AAAAGGCAACAGCCCCACTCAGG + Intergenic
967754700 3:193156186-193156208 CAAAGGCAGCAGTGCACGTTTGG + Intergenic
968619401 4:1597100-1597122 AAGAGGCTGGAGTCCCAGTGAGG - Intergenic
968829067 4:2922795-2922817 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
969132482 4:5002023-5002045 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
969909158 4:10427729-10427751 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
970714750 4:18908226-18908248 GAGAGGCAGCAGCCCCAGTCAGG + Intergenic
970727207 4:19060623-19060645 GAAAGGCAGAAGCCCCAGTCAGG + Intergenic
970756003 4:19427979-19428001 TTAAGGCAGCAATACCAGTTTGG + Intergenic
970962983 4:21895053-21895075 GTAAGGCAGCAGTCCCACTATGG - Intronic
971147526 4:23995159-23995181 AAAACCCACCAGTCCCTGTTTGG - Intergenic
971186479 4:24382719-24382741 CAAAGGCAGCAGCACCAGTCAGG + Intergenic
971673578 4:29595357-29595379 GAAAGGCAGCAGCCCCAGTAAGG - Intergenic
971679065 4:29673625-29673647 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
971883274 4:32409846-32409868 GAAAGGCAGCAGCCCTAGTCGGG + Intergenic
971943175 4:33241291-33241313 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
972219352 4:36936099-36936121 GAAAGGCATCAGCCCCAGTCAGG + Intergenic
972239034 4:37169244-37169266 AGAAGCAAGCAGTGCCAGTTTGG - Intergenic
972261062 4:37408510-37408532 AAAAGGCAGCAGACCCAGTCAGG + Intronic
972297017 4:37749149-37749171 AACAGGCAGCAGACCCTATTTGG - Intergenic
972651133 4:41018833-41018855 AAAGGGAAGCAGGACCAGTTGGG + Intronic
972743243 4:41909166-41909188 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
973081824 4:46002932-46002954 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
973273036 4:48280396-48280418 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
973556784 4:52091866-52091888 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
973562672 4:52151981-52152003 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
973629134 4:52802438-52802460 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
973660936 4:53105669-53105691 GTAAGGCAGCAGCCCCAGTCAGG + Intronic
973798424 4:54451678-54451700 GGAAGGCAGCAGCCCCAGTTAGG + Intergenic
973837523 4:54825182-54825204 GAAAGGCAGAAGCCCCAGTCAGG + Intergenic
974106217 4:57472532-57472554 CAAAGGCAGCAGCCCCAGTCAGG - Intergenic
974161782 4:58150023-58150045 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
974280051 4:59780616-59780638 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
974307068 4:60156021-60156043 AAAAGTCAGCAGCCCCAGTCAGG - Intergenic
974326272 4:60419018-60419040 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
974491600 4:62571584-62571606 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
974560114 4:63506420-63506442 GAAATGCAGCAGCCCCAGTCAGG + Intergenic
974793035 4:66714380-66714402 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
974813990 4:66982224-66982246 GAAAGGCAGCAGCCCCAGTTGGG + Intergenic
974851751 4:67412380-67412402 GAATGGCAGCAGCCCCAGTCAGG - Intergenic
974943853 4:68503421-68503443 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
974946594 4:68536060-68536082 GAAAGGCAGCAGCACCAGTCAGG - Intergenic
975104146 4:70549077-70549099 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
975149374 4:71004617-71004639 GAAAGGCAGCAGCCCCCGTCAGG - Intronic
975305695 4:72846739-72846761 AACAGGCAGCAGCCCCAGTCAGG + Intergenic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
975367387 4:73544916-73544938 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
975424945 4:74214864-74214886 GAAAGGCAGCAGCCCCTGTCAGG - Intronic
975466311 4:74713618-74713640 GAAAGGCAGCAACCCCAGTCAGG - Intergenic
975479351 4:74860289-74860311 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
975511219 4:75195153-75195175 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
975513731 4:75221798-75221820 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
975524279 4:75331785-75331807 CAAAGCCAGCAGCCCCAGTCAGG + Intergenic
975533027 4:75420590-75420612 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
975620306 4:76290312-76290334 GAAAGACAGCAGCCCCAGTCAGG - Intronic
975650572 4:76588835-76588857 AAAAGGTAGCACTCCTTGTTAGG + Intronic
975764718 4:77655222-77655244 GAAAGTCAGCAGCCCCAGTCAGG + Intergenic
975831716 4:78375972-78375994 AAAATGCAGCATTCCCAATTTGG + Intronic
976061228 4:81130648-81130670 GAAAGGCAGCAGTCCCACTCAGG - Intronic
976065585 4:81183976-81183998 GAAAGGCAGCAGCCCCAGGAAGG + Intronic
976092745 4:81474156-81474178 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
976114888 4:81715721-81715743 GAAAGGCGGCAGCCCCAGTCAGG + Intronic
976167636 4:82272252-82272274 AAAAGGCAGCAGACCCAGTCAGG + Intergenic
976193638 4:82512921-82512943 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
976363087 4:84203097-84203119 GAAAGGGAGCAGCCCCAGTCAGG + Intergenic
976438327 4:85044129-85044151 AAAAGGCAGCAGCCCCAACCAGG + Intergenic
976439310 4:85055250-85055272 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
976445943 4:85129773-85129795 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
976449103 4:85166347-85166369 AAAAGTCAGCAGCCCCAGTCAGG - Intergenic
976655893 4:87488746-87488768 GTAAGGCAGCAGCCCCAGTCAGG - Intronic
976710677 4:88067751-88067773 AAAATGCAGGAGTCCCAGCCTGG + Intronic
976715970 4:88122645-88122667 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
976720839 4:88167352-88167374 AAAAGGCAGAAGGGACAGTTGGG - Intronic
976809914 4:89089736-89089758 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
976852862 4:89568243-89568265 GAAAGGCACCAGCCCCAGTCAGG - Intergenic
976861538 4:89671906-89671928 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
976903489 4:90208156-90208178 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
977154508 4:93555588-93555610 GAAAGGCAGCAACCCCAGTCAGG + Intronic
977185624 4:93932462-93932484 GTAAGGCAGCAGCCCCAGTATGG - Intergenic
977438941 4:97037750-97037772 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
977467722 4:97403010-97403032 GAAAGGCAGCAGCCCCAGTTAGG - Intronic
977500296 4:97828855-97828877 AAAAGGCAGCTGCCCTGGTTAGG + Intronic
977561308 4:98536656-98536678 AAAAGGTAGCAGCCCCAGTCAGG - Intronic
977573727 4:98656408-98656430 AAAAAGAACCAGTCCCAGTTCGG + Intronic
977631443 4:99247866-99247888 GAAAGGCAGCAGGCCCAGTCAGG - Intergenic
977671426 4:99699552-99699574 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
977792966 4:101129229-101129251 GAATGGCAGCAGCCCCAGTCAGG + Intronic
977897795 4:102383984-102384006 GAAAGGCAGCAACCCCAGTCAGG - Intronic
977986211 4:103385878-103385900 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
977994489 4:103485243-103485265 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
978139093 4:105297427-105297449 GAAAGGCAGCAGCACCAGTCAGG + Intergenic
978179504 4:105776002-105776024 GAAAGGCAGCTGCCCCAGTCGGG - Intronic
978236886 4:106471215-106471237 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
978477228 4:109144554-109144576 GAAAGGCAGCAGCCCTAGTCAGG - Intronic
978601384 4:110431823-110431845 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
978664324 4:111164513-111164535 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
978699740 4:111628110-111628132 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
979012351 4:115387730-115387752 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
979022846 4:115524957-115524979 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
979115307 4:116815578-116815600 AAAAGGCAGCAGCCTCAGTCAGG + Intergenic
979417488 4:120461138-120461160 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
979421423 4:120509595-120509617 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
979457631 4:120944556-120944578 AAAAGGCAGCAGCCACAGTCAGG + Intergenic
979512257 4:121567771-121567793 AAAAGGCAGCAGCCACAGTCAGG + Intergenic
979578029 4:122318857-122318879 AAAAAGCAGCAGGCCCAGGTGGG - Intronic
979581392 4:122365304-122365326 AAAAGGCAGCAGCCCCAGTCGGG + Intergenic
979588227 4:122445962-122445984 AAAAGGCAGCAGCCCCAGTTAGG - Intergenic
979668245 4:123336342-123336364 TAAAGGCAGCAGCCCCAGTCAGG - Intergenic
979698290 4:123639099-123639121 TAAAGGCAGCAGCCCCAGTTAGG + Intergenic
979965946 4:127076995-127077017 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
979998678 4:127463809-127463831 AAAAGGCGGCAGCCCCAGTCAGG - Intergenic
980100286 4:128535526-128535548 AAAAGGCAGCAGCTCTAGTCAGG - Intergenic
980151641 4:129055440-129055462 GAAAGGCAGCAGCCCCAGTTAGG - Intronic
980157603 4:129126179-129126201 GAAAGGCAGTAGCCCCAGTCAGG - Intergenic
980171261 4:129292598-129292620 GAAAGGCAGCAGCCCCATTCAGG - Intergenic
980477275 4:133334009-133334031 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
980494144 4:133569980-133570002 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
980621491 4:135312140-135312162 AAAAGGCAGACTTCCAAGTTAGG - Intergenic
980633888 4:135473605-135473627 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
980733205 4:136848635-136848657 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
980888097 4:138785282-138785304 GAAAGGCAGCAGCCCCAGCCAGG - Intergenic
981202150 4:141992670-141992692 GAAAGGCAGCAGCCCCAGTCCGG - Intergenic
981273202 4:142868199-142868221 GAAAGACAGCAGCCCCAGTCAGG + Intergenic
981296690 4:143140845-143140867 GAAAGACAGCAGCCCCAGTCAGG + Intergenic
981429556 4:144644731-144644753 ATAAGGCAGTTGTCCCATTTTGG - Intergenic
981443502 4:144809347-144809369 GAAAGGAAGCAGCCCCAGTCAGG + Intergenic
981553706 4:145968054-145968076 GAAATGCAGCAGCCCCAGTCAGG - Intergenic
981629732 4:146804717-146804739 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
981662546 4:147184365-147184387 GAAAGGCAGCAGCCACAGTAAGG + Intergenic
981671569 4:147292943-147292965 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
981749895 4:148083059-148083081 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
981859819 4:149341193-149341215 GAAAGGCAGGAGTCCCAGTCAGG - Intergenic
981885369 4:149666909-149666931 GAAAGGCAGCAGCACCAGTCAGG + Intergenic
981939999 4:150271842-150271864 AAAAGGCAGCAGCCCCAGTTAGG + Intronic
982060247 4:151597687-151597709 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
982280165 4:153676233-153676255 AAATGGAAGAAGTCCCAGTGGGG + Intergenic
982298927 4:153859389-153859411 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
982323911 4:154109264-154109286 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
982725571 4:158902642-158902664 AAAAGGCAGCAGCCCCAGTTAGG - Intronic
982733245 4:158979027-158979049 GAAAGGCAGCACCCCCAGTCAGG - Intronic
982733445 4:158980187-158980209 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
982794514 4:159629371-159629393 GAAAGGAAGCAGCCCCAGTCAGG - Intergenic
982852924 4:160342132-160342154 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
982909190 4:161117905-161117927 GAAAGGCAGCAACCCCAGTCAGG - Intergenic
982962807 4:161861583-161861605 AAAATCCAGCAGTCCAATTTTGG + Intronic
983044484 4:162969521-162969543 GAAAGGAAGCAGCCCCAGTCAGG - Intergenic
983047447 4:163004378-163004400 AAAAGGCAACAGCCCCACTCAGG - Intergenic
983331355 4:166333398-166333420 GAAAGGCAGCAGCCTCAGTCAGG - Intergenic
983543322 4:168935744-168935766 GAAAGGCAGCAGTCCCAGTCAGG + Intronic
983596284 4:169471783-169471805 GAAAGGTAGCAGCCCCAGTCAGG - Intronic
983602706 4:169548625-169548647 AAAAGGCAGTAGCCCCAGTCAGG - Intronic
983788097 4:171759607-171759629 AAAATGCAGCAGTCCCAGTCAGG + Intergenic
983840891 4:172455689-172455711 AGAAGGCAGCAGCCACAGTCAGG + Intronic
983896194 4:173084471-173084493 GAAAGGTAGCAGCCCCAGTCAGG - Intergenic
984009045 4:174348271-174348293 GAAAGGCAGCATCCCCAGTCAGG - Intergenic
984269794 4:177536769-177536791 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
984354232 4:178637464-178637486 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
984618677 4:181927505-181927527 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
984902981 4:184601161-184601183 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
985204501 4:187520959-187520981 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
985721471 5:1491666-1491688 AAAATGCGCCAGTCCCAGTGTGG - Intronic
986005982 5:3669580-3669602 GAAAGGCAAGAGCCCCAGTTAGG - Intergenic
986096118 5:4555550-4555572 AACAGGCAACAGCCCCAGCTCGG + Intergenic
986110389 5:4710128-4710150 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
986358568 5:6952573-6952595 GAAAGGCAGCGGTCTCAGTCAGG + Intergenic
986378800 5:7162461-7162483 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
986581687 5:9272344-9272366 AACATGCAGCAGCCCCAGTCAGG + Intronic
986838808 5:11672440-11672462 AAAAGTGAGCAGCCCCAGTCAGG - Intronic
986920491 5:12673925-12673947 GAAAGGCAGGAGTTCCAGTCAGG - Intergenic
987228790 5:15870793-15870815 GAAAGGCAGCAGCCCCACTCAGG + Intronic
987528172 5:19080337-19080359 AAAAGGCAGCAGCCCTAGTCAGG - Intergenic
987687621 5:21225740-21225762 AAAAGGCATCAGCCCCGGTCAGG + Intergenic
987924051 5:24317625-24317647 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
988242143 5:28627249-28627271 AGAATCCAGCAGTCTCAGTTGGG + Intergenic
988587888 5:32523600-32523622 AGTAGGCAGCAGTCCCGGTGTGG - Intergenic
988618249 5:32795491-32795513 GAAAAGCAGCAGCTCCAGTTAGG + Intergenic
988627993 5:32898524-32898546 GAAAGGCAACAGCCCCAGTCAGG - Intergenic
988719241 5:33859491-33859513 GAAAGGCAGCAGCTCCAGTCAGG + Intronic
988766992 5:34388834-34388856 GAAAGACAGCAGCCCCAGTCAGG - Intergenic
988772555 5:34447449-34447471 ATAAGGCAGCAGCTCCAGTCAGG - Intergenic
988775009 5:34469559-34469581 GAAAAGCAGCAGCCCCAGTCAGG + Intergenic
988867677 5:35353713-35353735 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
989084049 5:37656604-37656626 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
989194197 5:38700119-38700141 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
989320685 5:40130709-40130731 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
989675211 5:43965610-43965632 AAATGGCAGCAGCCCCAGTCAGG - Intergenic
989687589 5:44108193-44108215 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
990098886 5:52157125-52157147 GAAAGCCAGCAGCCCCAGTCAGG + Intergenic
990164305 5:52977569-52977591 GAAAGGCAGCAGCCCCAGTGAGG - Intergenic
990183737 5:53190992-53191014 GAAAGGCAGCAGCCTCAGTCAGG - Intergenic
990673849 5:58161980-58162002 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
990745824 5:58958744-58958766 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
990803534 5:59632225-59632247 GAAAGGTAGCAGCCCCAGTCAGG + Intronic
990837832 5:60042279-60042301 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
990897562 5:60715573-60715595 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
991026641 5:62037305-62037327 AAAAGGCAGCAGCCACAGTCAGG - Intergenic
991110713 5:62896496-62896518 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
991128161 5:63090778-63090800 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
991150411 5:63361020-63361042 AAAAGGGAGCAGCCCCAGTCAGG - Intergenic
991161405 5:63507749-63507771 AAAAGACAGCAGCCCCAGTCAGG + Intergenic
991236736 5:64407453-64407475 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
991283201 5:64939774-64939796 GAAAGGCAGCGGTCCCATTCAGG - Intronic
991417197 5:66405194-66405216 AAAAGGCAGCAGCCCCAGTAAGG - Intergenic
991652105 5:68865750-68865772 GAAAGGCAGCAGTGCCAGTCAGG + Intergenic
991928467 5:71728238-71728260 GAAAGGCAGCAGCCGGAGTTGGG - Intergenic
991934791 5:71790581-71790603 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
992038845 5:72808686-72808708 GAAAGGCAGTAGCCCCAGTCAGG - Intergenic
992254845 5:74911424-74911446 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
992287314 5:75248608-75248630 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
992292408 5:75292901-75292923 GAAAGGCAGCAGCCACAGTCAGG - Intergenic
992383813 5:76265110-76265132 GAAAGGCAGCAGCCCCAGTTAGG - Intronic
992506043 5:77388729-77388751 AAAAGGCAGCATTCCCAGTCAGG - Intronic
992740585 5:79769960-79769982 GAAAGGTAGCAGCCCCAGTCAGG - Intronic
992976871 5:82130001-82130023 AACAGGCAGCAGCCCCAGTCAGG - Intronic
993119160 5:83753944-83753966 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
993145224 5:84085851-84085873 GAAATGCAGCAGCCCCAGTCAGG - Intronic
993166026 5:84355943-84355965 GAAAGGCAGCAGCCCAAGTCAGG - Intronic
993265512 5:85721805-85721827 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
993291865 5:86082586-86082608 AAAAGGCAGTAGCCCCAGTCAGG - Intergenic
993345545 5:86777982-86778004 AAAAGGCAGAAGCCCCAGTCAGG - Intergenic
993358612 5:86945418-86945440 AAAAGGTGGCAGTCTCAGTAGGG - Intergenic
993381828 5:87217525-87217547 CAAAGGCAGCAGCCCCAGTCAGG - Intergenic
993403968 5:87488293-87488315 GAAAGGCAGCAGCCCCAATCAGG + Intergenic
993410443 5:87567183-87567205 GAAAGGCAGCTGACCCAGTCAGG - Intergenic
993455318 5:88120715-88120737 GAAAGGCAGCAACCCCAGTCAGG + Intergenic
993513397 5:88799302-88799324 GAAAGGAAGCAGCCCCAGTCAGG - Intronic
993609041 5:90031992-90032014 GAAAGGCAGAAGCCCCAGTTAGG + Intergenic
993673989 5:90795479-90795501 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
993757594 5:91750871-91750893 GAAAGGCAGCAGGCCCAGTCAGG - Intergenic
993891721 5:93482934-93482956 GAAAGGCAGCAGACCCAATCAGG + Intergenic
993895021 5:93523331-93523353 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
993911585 5:93690536-93690558 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
994137930 5:96309115-96309137 CAAAGGCAGCAGCCCCAGTCAGG - Intergenic
994142827 5:96360990-96361012 AAAAGGCAGCAATCCCAGTCAGG - Intergenic
994233510 5:97336047-97336069 AAAAGTCAGCAGCCCCAGTCAGG - Intergenic
994378107 5:99038087-99038109 ATAGGGCAGCAGCCCCAGTCAGG + Intergenic
994438031 5:99763453-99763475 GAAAGGCAGCAGCCCCTGTCAGG - Intergenic
994622439 5:102179171-102179193 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
994641992 5:102421603-102421625 GAAAAGCAGCAGCCCCAGTCTGG + Intronic
994721534 5:103385826-103385848 GAAAGGCAGCAGCCCCAGTCTGG - Intergenic
994918016 5:106004529-106004551 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
994991279 5:106999915-106999937 GGAAGGCAGCAGCCCCATTTAGG - Intergenic
995108236 5:108399260-108399282 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
995111887 5:108437745-108437767 AAAAGGTAGCAGCCCCAGTCTGG + Intergenic
995136545 5:108685772-108685794 AAACGACAGCAGCCCCAGTCAGG - Intergenic
995162464 5:108997788-108997810 AAAAGGCAGCAGCCACAGTCAGG - Intronic
995252245 5:110006655-110006677 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
995263752 5:110135614-110135636 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
995301942 5:110594767-110594789 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
995326183 5:110892703-110892725 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
995464441 5:112436418-112436440 GAAAGGCAGCAACCCCAGTCAGG + Intergenic
995475070 5:112539436-112539458 CAAAGGCAGCAACCCCAGTCAGG + Intergenic
995620638 5:114021732-114021754 AAAAGGCAGCTGTCCCAGTCAGG + Intergenic
995695771 5:114876702-114876724 AAAAGGCAGCAACCCCAGTAAGG + Intergenic
995790625 5:115882858-115882880 GAAAGGCAACAGCCCCAGTCAGG - Intronic
995808594 5:116080660-116080682 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
995811119 5:116108332-116108354 AAAAGGCAGTAGCCTCAGTCAGG - Intronic
996129972 5:119770011-119770033 GAAAGGCAGCAGCCCCACTCAGG + Intergenic
996242551 5:121221398-121221420 GAAAGGCAGCAGCTCCAGTCAGG + Intergenic
996251082 5:121333341-121333363 GAAAAGAAGCAGTCCAAGTTGGG + Intergenic
996270817 5:121602636-121602658 AAAAGGCAGCAGCCCCACTCAGG + Intergenic
996324033 5:122252373-122252395 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
996420684 5:123258794-123258816 AGAAGGCATCAGCCCCAGTCAGG - Intergenic
996426587 5:123319988-123320010 GAAAGGGAGCAGCCCCAGTCAGG - Intergenic
996953276 5:129153133-129153155 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
996987466 5:129584553-129584575 GAAGGGCAGCAGCCCCAGTCAGG - Intronic
997004582 5:129803384-129803406 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
997004801 5:129804770-129804792 AAAAGGCAGCAGCCGCAGTCAGG - Intergenic
997171778 5:131729342-131729364 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
997216683 5:132117243-132117265 AAAAGGCAGCAGCCCCAATCAGG + Intergenic
997220328 5:132157077-132157099 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
997252319 5:132398588-132398610 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
997800228 5:136853411-136853433 GAAAGGCAGCAGTCCCAGTTAGG - Intergenic
997809502 5:136953703-136953725 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
997902789 5:137783436-137783458 AAAAGGCAGCATCCCAAGTCAGG + Intergenic
998019257 5:138755757-138755779 AAGAGACAGGAGTCCCACTTTGG - Intronic
998043001 5:138965182-138965204 AAAGGGCAGGAGTCCCACTGTGG - Intronic
998342045 5:141426941-141426963 GAATTGCAGCAGTGCCAGTTGGG - Intronic
998717751 5:144905584-144905606 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
998752060 5:145333428-145333450 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
998768246 5:145512477-145512499 GAAAGGCAGCAGCCCCAGTAAGG + Intronic
998934223 5:147216846-147216868 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
998972747 5:147610841-147610863 GAAAGGCAGCAGCCCCATTCAGG - Intronic
999030038 5:148280941-148280963 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
999488689 5:152026665-152026687 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
999489808 5:152038956-152038978 AAAAGGCAGCAGCCCCAGTAAGG - Intergenic
999502348 5:152159965-152159987 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
999983958 5:156984926-156984948 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1000194735 5:158946844-158946866 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1000582187 5:163048298-163048320 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1000590066 5:163147213-163147235 GAAGGGCAGCAGCCCCAGTCAGG + Intergenic
1000767068 5:165305337-165305359 AGAAGGCAGCAGTCTAAATTGGG - Intergenic
1000860391 5:166450186-166450208 GAAGGGCAGCAGCCCCAGTCAGG - Intergenic
1001346357 5:170903157-170903179 GAAAGGCAGCAGACCCAGTCAGG - Intronic
1001362640 5:171103258-171103280 GAAGGGCAGCAGCCCCAGTCAGG - Intronic
1002578433 5:180192120-180192142 AAAAGGGAGATGTCCCAGGTGGG - Intronic
1002673565 5:180890180-180890202 GAAAGGCAGCAGTACCAGTCAGG + Intergenic
1002685817 5:181008494-181008516 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
1002944836 6:1751054-1751076 GAAAGGCAGCAACCCCAGTCAGG + Intronic
1003228674 6:4229489-4229511 AAAAGGCAGCAGCCCCAGTTGGG + Intergenic
1003316786 6:5020187-5020209 AGAAGGCAGCAGCCACAGTCAGG - Intergenic
1003416861 6:5917503-5917525 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1003713475 6:8619470-8619492 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1003736271 6:8880905-8880927 AGAAGGCAGCAGCACCAGTGTGG - Intergenic
1004028021 6:11837676-11837698 GAAAGGCAGCAGCCCCAATCAGG + Intergenic
1004413090 6:15400038-15400060 AAAAGGCAGGAGTCCAACTGAGG - Intronic
1004593249 6:17073913-17073935 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1005376264 6:25185698-25185720 AAAAGGCAGAAGCCCCAGTCAGG - Intergenic
1005378306 6:25207705-25207727 GAAAAGCAGCAGCCCCAGTCAGG + Intergenic
1005795793 6:29360246-29360268 GAAAGGCAGCAGTCCCAGTCAGG + Intronic
1006198352 6:32262953-32262975 AAAAGGCAGCAACCCCAGTCGGG - Intergenic
1006915266 6:37589847-37589869 AAAGGGCAGAAGTCCCAGGAGGG - Intergenic
1007195575 6:40056938-40056960 AAAAGGCATCAGCCCCAGTCAGG - Intergenic
1007858166 6:44879408-44879430 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1008176184 6:48270706-48270728 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
1008407562 6:51136101-51136123 GAAAGGCAGCAGCTCCAGTCAGG - Intergenic
1008575429 6:52856209-52856231 AAAAGGCAGCAGCCTCAGCCAGG - Intronic
1008782703 6:55126735-55126757 ATAAGGCAGCAGCCCCAGTCAGG - Intronic
1008864020 6:56188469-56188491 ATAAGGCAGCAGCGCCAGTCAGG + Intronic
1008896811 6:56565856-56565878 AAAAGGCAGCAGCACCAGTCAGG - Intronic
1008993926 6:57636741-57636763 AAAAGGCAGTAGCCCCAGTCAGG + Intronic
1008997872 6:57679967-57679989 AAAAGGCAGCAGCCCCAGTGAGG + Intergenic
1009182532 6:60535831-60535853 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1009186359 6:60579305-60579327 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1009264148 6:61532275-61532297 GAAAGGCAGCAGCCGCAGTCAGG + Intergenic
1009290131 6:61870374-61870396 AAAAGGCAGCAGCCTCATTCAGG + Intronic
1009305872 6:62088878-62088900 GAAAGGCAGCAGCACCAGTCAGG - Intronic
1009336090 6:62492504-62492526 GTAAGGCAGCAGCCCCAGTCAGG + Intergenic
1009458787 6:63888121-63888143 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1009512280 6:64568464-64568486 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1009536713 6:64896938-64896960 GAAAGGCAGCAGCCCCACTCAGG + Intronic
1009570207 6:65374864-65374886 GAAAGGCAGCTGCCCCAGTCAGG + Intronic
1009606525 6:65876419-65876441 TAAAGGCAGCAGTAACAGGTGGG - Intergenic
1009652091 6:66489547-66489569 ACAAGGCAGCAGAACCAGTCAGG + Intergenic
1009740212 6:67734224-67734246 GAAATGCAGCAGCCCCAGTCAGG - Intergenic
1009775927 6:68206092-68206114 TAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1009777079 6:68218612-68218634 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1009795034 6:68455967-68455989 AAAAGGCAGAAGCCGCAGTCAGG - Intergenic
1009880541 6:69560952-69560974 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1009945330 6:70336284-70336306 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1010006259 6:70998497-70998519 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1010039117 6:71360978-71361000 CAAAGGCTGCAGCCCCAGTCAGG - Intergenic
1010276368 6:73972582-73972604 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1010459496 6:76098029-76098051 GAAAGGCAGCAACCCCAGTCAGG + Intergenic
1010522027 6:76849613-76849635 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1010615372 6:78005958-78005980 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1010668282 6:78655487-78655509 GAAAAGCAGCAGCCCCAGTCAGG - Intergenic
1010681772 6:78807296-78807318 AAAAGGAAGCAGCCCCAGTGAGG - Intergenic
1010822651 6:80433320-80433342 AAAAGGCAGCAGCCCCAGTTGGG - Intergenic
1010936613 6:81870077-81870099 GAAAGGCAGCAGCCCCATTAAGG + Intergenic
1010973106 6:82284018-82284040 AAAAGGCAGCAGACCAAGTCAGG - Intergenic
1010994041 6:82512762-82512784 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1011065529 6:83321633-83321655 GAAAAGCAGCAGCCCCAGTCAGG + Intronic
1011086514 6:83546951-83546973 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1011137377 6:84115232-84115254 AAAAGGCAGTAGCCCCAGTCAGG - Intergenic
1011139194 6:84134019-84134041 TAAAGGCAGCAGCCCCAGTCAGG - Intronic
1011174133 6:84541304-84541326 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1011209200 6:84936529-84936551 AAAAGGCAGCAGGCCCAGTCAGG + Intergenic
1011235553 6:85212820-85212842 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1011302616 6:85892291-85892313 AAAAGACAGCAGCCCCAGTCAGG - Intergenic
1011340270 6:86306548-86306570 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1011766296 6:90623589-90623611 GAAAGGCAACAGCCCCAGTGAGG + Intergenic
1011776757 6:90739416-90739438 GAAAGGTAGCAGCCCCAGTCAGG - Intergenic
1012043441 6:94239165-94239187 AAAAGGTAGCAGCCCCAGTTAGG + Intergenic
1012127903 6:95453906-95453928 GAAAGGCAGCAGCCCCGGTCAGG - Intergenic
1012207439 6:96478562-96478584 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1012597087 6:101053808-101053830 GAAAGGCAGCAGCCCTAGTCAGG - Intergenic
1012644377 6:101661132-101661154 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1012778031 6:103522379-103522401 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1012870919 6:104671561-104671583 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1013038022 6:106405366-106405388 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1013200689 6:107892207-107892229 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1013229459 6:108148824-108148846 AAAATGCAGCACTCCAAGCTGGG + Intronic
1013320215 6:108980659-108980681 AAAAGGCAGCAGGCCCAGTCAGG - Intergenic
1013390276 6:109679436-109679458 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1013625633 6:111934624-111934646 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1013682626 6:112541816-112541838 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
1013901877 6:115166306-115166328 GAAAGATAGCAGTCCCAGTCAGG - Intergenic
1013920116 6:115394244-115394266 GAAAGACAGCAGCCCCAGTCAGG - Intergenic
1013939622 6:115645632-115645654 GAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1013956947 6:115852784-115852806 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
1013972937 6:116042230-116042252 CAAAGGCAGCAGCCCCAATCAGG + Intronic
1014113416 6:117646084-117646106 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1014129067 6:117810655-117810677 GAAAGGTAGCAGCCCCAGTCAGG - Intergenic
1014225275 6:118840079-118840101 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1014272479 6:119349603-119349625 AAGAGGCAGCAGTCTCAGCGCGG - Exonic
1014278876 6:119418442-119418464 GAAAGGCAGCAATCCCAGTCAGG + Intergenic
1014352639 6:120363422-120363444 CAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1014413381 6:121153651-121153673 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1014569074 6:122986673-122986695 GAAAGGCAGCAGCCCCAATCAGG + Intergenic
1014584632 6:123182915-123182937 GAAAGGCAGCAGCCCCAGTTAGG + Intergenic
1014724069 6:124955080-124955102 ACAAGGCAGCTGGCCCAGCTGGG + Intergenic
1014836523 6:126166769-126166791 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1014922463 6:127228970-127228992 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1015291111 6:131539046-131539068 AAAAGGCAGCAGTCCCAGTCAGG + Intergenic
1015387001 6:132635608-132635630 GAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1015433191 6:133154725-133154747 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1015500794 6:133931169-133931191 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1015623362 6:135155995-135156017 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1015943948 6:138480470-138480492 AAAAGCCAGAAGGACCAGTTCGG + Intronic
1016111503 6:140230612-140230634 AAAAGGCAGCAACACCAGTCAGG + Intergenic
1016234439 6:141846009-141846031 AAAAGGTAGCAGATCCTGTTAGG - Intergenic
1016241898 6:141940579-141940601 GAAAGGCAGCAGCTCCAGTCAGG + Intergenic
1016338528 6:143035040-143035062 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1016638521 6:146322552-146322574 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1016691504 6:146943266-146943288 GAAAGGCAGCAGCCCCAGTAGGG - Intergenic
1016855992 6:148671233-148671255 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1016985860 6:149895352-149895374 ACAAGGCAGCAGCCCCAATCAGG - Intronic
1017028375 6:150200376-150200398 AAAAGGGAGCTGTCCCAGAGAGG - Intronic
1017126029 6:151065563-151065585 AGAAGGCATCACTCCCAGTGGGG - Intronic
1017197383 6:151716489-151716511 GAAAGGCAGCAGTCCCAGTCAGG - Intronic
1017322662 6:153111423-153111445 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1017571440 6:155749070-155749092 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
1017968673 6:159290192-159290214 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1018094488 6:160373665-160373687 GAAAGGCAGAAGCCCCAGTCAGG - Intronic
1018507800 6:164490618-164490640 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1018564123 6:165133587-165133609 AACTTGCAGCAATCCCAGTTTGG + Intergenic
1018797616 6:167199551-167199573 GAAAGGCAGCAGTCTCAGTCAGG - Intergenic
1019071874 6:169353512-169353534 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1019203636 6:170341164-170341186 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1020333443 7:7042618-7042640 AAAAGACAGCAGCCCCAGTCAGG + Intergenic
1020358248 7:7300968-7300990 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1020391379 7:7661966-7661988 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1020428667 7:8096711-8096733 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1020487634 7:8738781-8738803 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1020603573 7:10307020-10307042 AAAAGAATGCATTCCCAGTTGGG + Intergenic
1020608571 7:10367394-10367416 GAAAGGCAGCAGGTCCAGTCAGG - Intergenic
1020635997 7:10696368-10696390 AAATGGCAGTAGCCCCAGTCAGG + Intergenic
1020693790 7:11391255-11391277 AAAAGGCAGGAGCCCCAGTCAGG - Intronic
1020694069 7:11392865-11392887 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1020753387 7:12170515-12170537 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1020823817 7:13002620-13002642 GAAAGGCAGCAGCCTCAGTAAGG - Intergenic
1020874239 7:13673677-13673699 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1021046938 7:15934500-15934522 AAACCGCAGCATTTCCAGTTTGG + Intergenic
1021071684 7:16249210-16249232 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1021166975 7:17354101-17354123 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1021206039 7:17782307-17782329 AAAAGGCAGCAGGCCCAAAATGG + Intergenic
1021224526 7:18012497-18012519 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1021322338 7:19227362-19227384 GAAAAGCAGCAGCCCCAGTTAGG + Intergenic
1021407541 7:20290240-20290262 AAAAGGCTGGATTTCCAGTTTGG - Intergenic
1021483979 7:21147020-21147042 AAATGGCAGCAGCCCCAGTCAGG + Intergenic
1021502285 7:21344942-21344964 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1021782280 7:24117982-24118004 AAAAGGCAGCAGCCCCTGTCAGG - Intergenic
1021805664 7:24352620-24352642 GAAAGGCAGCAGCCCCAGACAGG + Intergenic
1022058816 7:26770112-26770134 GAAAGGCAGCAGCCTCAGTCAGG - Intronic
1022848434 7:34235293-34235315 AAAAGGCAGCAGTCCCAGTAAGG - Intergenic
1022869152 7:34457698-34457720 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
1023061621 7:36332989-36333011 GAAAGGCAGCAGCCCCACTAAGG + Intronic
1023511593 7:40959325-40959347 GAAAGGCAGCAGCCGCAGTCAGG - Intergenic
1023602432 7:41892923-41892945 AAAAGCCAGAAGGCCCAGTGAGG + Intergenic
1024017748 7:45333312-45333334 GAAAGGCAGCAGCTCCAGTCAGG + Intergenic
1024153009 7:46591510-46591532 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1024372887 7:48606872-48606894 AAACGGCAGCAGCCCCAGTCAGG - Intronic
1024495477 7:50041140-50041162 GAAAGGCAGCAGCCCCAGGCAGG + Intronic
1024664873 7:51536419-51536441 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1024703327 7:51928144-51928166 AAAAGGCAGCAGCCCCCATCAGG - Intergenic
1024950486 7:54855683-54855705 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1024998491 7:55294571-55294593 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1025621362 7:63174655-63174677 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1025637909 7:63339787-63339809 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1025644788 7:63408312-63408334 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1025714420 7:63941726-63941748 GAAAGGTAGCAGCCCCAGTCAGG + Intergenic
1026488173 7:70838656-70838678 AAAAGGCAGCAGCCCCAGTCTGG + Intergenic
1027582918 7:80020605-80020627 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1027778188 7:82492386-82492408 AACAGGCAGCAGCCCCAGTAAGG - Intergenic
1027790425 7:82633861-82633883 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1027843385 7:83342107-83342129 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1027864540 7:83629449-83629471 GAAAGGCAGCAGCCCCAGGCAGG - Intronic
1027910688 7:84246012-84246034 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1028144331 7:87304839-87304861 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1028145847 7:87319173-87319195 ACAAGGCAGCAGCCTCAGTCAGG - Intergenic
1028327055 7:89540442-89540464 AAAAGGCAGCAGACCCAGTAAGG + Intergenic
1028347593 7:89801393-89801415 AAAATGCACAAGTCCCATTTAGG + Intergenic
1028523667 7:91759562-91759584 AAAAGGCAGGAGCTCCAGTCAGG + Intronic
1028627940 7:92898420-92898442 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1028630238 7:92926345-92926367 AAAAGGCAGCAGCCCAAGTCAGG - Intergenic
1028652817 7:93170068-93170090 AAAAGGCAACAGCCCCAGTCAGG - Intergenic
1028872048 7:95780848-95780870 AAAAGGAAGCAGGCCCTGTGGGG + Intronic
1028945579 7:96575625-96575647 GAAAGGCAGCACCCCCAGTCAGG - Intronic
1028998339 7:97126474-97126496 CAAAGGCAGCAGCCCCAATCAGG - Intronic
1029324723 7:99796371-99796393 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1029850542 7:103457160-103457182 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1029851074 7:103462402-103462424 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1029854866 7:103505050-103505072 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1030141005 7:106304144-106304166 GAAAGGCAGCAGCCCCAGACAGG - Intergenic
1030159571 7:106493355-106493377 GAAAGGCAGCAGTCCCTGTCAGG + Intergenic
1030245192 7:107377779-107377801 GAAAGGCAGAAGCCCCAGTCAGG + Intronic
1030403608 7:109083709-109083731 GAAAGGCAGCAGCCCCAGACAGG + Intergenic
1030482334 7:110120164-110120186 GAAAGGCAGCAGTCCAAGTCAGG + Intergenic
1030500788 7:110356440-110356462 GAAAGTCAGCAGCCCCAGTCAGG - Intergenic
1030534060 7:110744229-110744251 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1030612601 7:111705861-111705883 GAAAGGCAGCAGCACCAGTCAGG - Intergenic
1030703049 7:112662218-112662240 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1030705605 7:112689823-112689845 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1030771081 7:113475582-113475604 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1031173300 7:118317978-118318000 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1031397710 7:121293178-121293200 GAAAGGCAGCAGCCCTAGTCAGG - Intronic
1031613737 7:123856843-123856865 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1031711034 7:125046784-125046806 GAAAGGCAGCAGCCCCAGTTAGG + Intergenic
1031902683 7:127428419-127428441 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1032214917 7:129950526-129950548 AAAAGGCATCAGGTCAAGTTAGG + Intronic
1032295897 7:130638383-130638405 GAAAGGCAGCAGCCCCAGTTAGG - Intronic
1032312553 7:130802185-130802207 AAAAGGCAGCAGCCCCAATCAGG - Intergenic
1032604029 7:133330080-133330102 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1032659717 7:133970002-133970024 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1032883433 7:136114487-136114509 ATAAGGCAGCAGCCCCAGTCAGG - Intergenic
1032893351 7:136222963-136222985 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
1032911110 7:136431698-136431720 GAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1032957083 7:136984097-136984119 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1033525644 7:142210671-142210693 AAAAGGCAGCAGCCCCAGTTAGG + Intronic
1033680074 7:143584876-143584898 AAAAAGCAGCAGCCCCAGCCAGG + Intergenic
1033691761 7:143744566-143744588 AAAAAGCAGCAGCCCCAGCCAGG - Intergenic
1034097708 7:148425190-148425212 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1034314520 7:150117565-150117587 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1034365524 7:150543114-150543136 GAAAAGCAGCAGCCCCAGTCAGG + Intergenic
1034370738 7:150594391-150594413 GAAAGGCAGCAGCCGCAGTCAGG - Intergenic
1034792376 7:153983204-153983226 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1035155172 7:156906301-156906323 CAAAGGCAGCTGTCCAGGTTGGG + Intergenic
1035696483 8:1601530-1601552 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1035710786 8:1712361-1712383 AACAGGCAGCAGCCCCAGTCAGG + Intergenic
1035794091 8:2337393-2337415 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1035798713 8:2384315-2384337 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1036246929 8:7125902-7125924 ACAAGGCACCAGCCCAAGTTTGG - Intergenic
1036551229 8:9816438-9816460 AAAAGGCAGCAGCCCCAGGCGGG + Intergenic
1036558036 8:9877071-9877093 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1036887336 8:12568098-12568120 ACAAGGCACCAGCCCAAGTTTGG + Intergenic
1037258254 8:16979475-16979497 GAAAGGCAGCAGCCCCGGTCAGG - Intergenic
1037403669 8:18519369-18519391 AAAAAGCAGCAAGCCCTGTTGGG + Intergenic
1037647072 8:20801807-20801829 AGAAGGCAGCAGTGCCAGAACGG + Intergenic
1037719684 8:21431836-21431858 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1038083280 8:24164180-24164202 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1039133876 8:34298053-34298075 GAAAGGCAGCAGCCCCAATCAGG + Intergenic
1039145223 8:34439086-34439108 AAAAGGCAGCAACCCTAGTTAGG + Intergenic
1039283008 8:36006893-36006915 GAAAAGCAGCAGCCCCAGTCAGG + Intergenic
1039284592 8:36026854-36026876 AAAGGGCAGTAGCCCCAGTCAGG + Intergenic
1039754808 8:40512096-40512118 GAAAGACAGCAGCCCCAGTCAGG - Intergenic
1040355033 8:46608907-46608929 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1040520062 8:48169025-48169047 GAAAGGCAGCAGTCCCAGGCAGG - Intergenic
1040624824 8:49135252-49135274 CAATGGCAGCAGTCTTAGTTTGG + Intergenic
1040736581 8:50515785-50515807 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1040779934 8:51095453-51095475 AAAAGGCAGCAGCCCTAGTCAGG + Intergenic
1040849192 8:51881004-51881026 AAAAGACAGTAGTCCAAGTTTGG + Intronic
1040943011 8:52852330-52852352 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1040968778 8:53112141-53112163 AAAAGGAAGCAGCCTCAGTCAGG - Intergenic
1041050840 8:53932611-53932633 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1041383142 8:57273114-57273136 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1041419053 8:57646656-57646678 GAAAGGCAGCAGCTCCAGTCAGG - Intergenic
1041423591 8:57695655-57695677 GAAAGGCAGCAGTCCCATCAGGG + Intergenic
1041459713 8:58098201-58098223 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1041574776 8:59381378-59381400 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1041630538 8:60082592-60082614 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1041666344 8:60448550-60448572 GAAAGGCAGCAGCCCCGGTCAGG + Intergenic
1041836669 8:62223905-62223927 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1041838302 8:62241892-62241914 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1041944351 8:63424668-63424690 AAAAGATAGCAGCCCCAGTCAGG + Intergenic
1042070783 8:64931078-64931100 AAAAGGCAGCAGTCCCAGTCAGG - Intergenic
1042110960 8:65380427-65380449 GAAAAGCAGCAGTCCCAGTCAGG + Intergenic
1042195607 8:66229014-66229036 AAAAGGCAACAGCCCCAGTCAGG + Intergenic
1042327132 8:67540661-67540683 GAAAGGCTGCAGCCCCAGTAAGG - Intronic
1042349384 8:67761598-67761620 AAAAGGCAGCAGCCCCAGTCGGG + Intergenic
1042478836 8:69280677-69280699 GAAAGGCAGCGGCCCCAGTCAGG + Intergenic
1042622690 8:70724043-70724065 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1042812878 8:72845596-72845618 GAAAGGCAGCAGCCCCAGTCGGG - Intronic
1042946212 8:74156987-74157009 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
1043366289 8:79537097-79537119 GAAAGGCAGCAGCCCCAGACAGG - Intergenic
1043368240 8:79560310-79560332 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1043532466 8:81166141-81166163 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1043647218 8:82536022-82536044 GAAAGGCAGCAGCCCTAGTCAGG - Intergenic
1043748763 8:83909140-83909162 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1044067942 8:87721337-87721359 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1044267759 8:90203650-90203672 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
1044503600 8:92991235-92991257 AAAGGGCAGCAGCCCCAGTCAGG + Intronic
1044509441 8:93058156-93058178 GAAAGGCAGCAGACCCATTCAGG - Intergenic
1044912458 8:97074832-97074854 AAAAGGCAGGTGTCCCTGTGGGG + Intronic
1044940221 8:97334797-97334819 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1045151754 8:99416073-99416095 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1045185146 8:99830257-99830279 GAAAGGCAGCAGCCCTAGTCAGG - Intronic
1045199694 8:99967714-99967736 GAAAGCCAGCAGCCCCAGTCAGG + Intronic
1045212150 8:100109149-100109171 AAAAGGCAGCAGTCCCAGTCAGG + Intronic
1045265656 8:100616778-100616800 AAACGGAAGCACTCCCATTTTGG - Intronic
1045390615 8:101710747-101710769 GAAAGGCAGCAGCCCCATTCAGG + Intronic
1045618935 8:103952086-103952108 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1045797733 8:106065553-106065575 AAAAGGCAGCAGCCCTAGTCAGG + Intergenic
1045883160 8:107064844-107064866 AAAAGGCAGCAGCCCCATTCCGG - Intergenic
1045973367 8:108104266-108104288 GAAAGGCAGCAGCTCCAGTCAGG + Intergenic
1045975065 8:108122683-108122705 GAAAGGCAGCTGCCCCAGTCAGG - Intergenic
1046018524 8:108635334-108635356 CAGAGGCAGCAGTCTCAGATAGG - Intronic
1046067949 8:109218667-109218689 GAAAGGCAACAGCCCCAGTCAGG - Intergenic
1046153449 8:110257538-110257560 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1046219969 8:111201145-111201167 AAAAGGCAGCAGCCCGAGTCAGG + Intergenic
1046295896 8:112218609-112218631 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1046947442 8:119987689-119987711 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1046972509 8:120238265-120238287 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1046995533 8:120516989-120517011 AAAAAGCAGCAGTTACATTTGGG + Intronic
1047369550 8:124245202-124245224 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1048313173 8:133342003-133342025 ACAAGGCAGCAGGCCCAGGAGGG + Intergenic
1048700583 8:137084320-137084342 AAAAGGTAGCAGTCTCAGAAAGG - Intergenic
1048914081 8:139165332-139165354 ACAAGGCAGCGGCCCCAGTCAGG - Intergenic
1048961203 8:139579886-139579908 CTAAGGCAGCATTACCAGTTGGG - Intergenic
1049872340 8:144990472-144990494 GAAATGCAGCAGCCCCAGTCAGG - Intergenic
1050031802 9:1393864-1393886 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
1050130119 9:2403328-2403350 GAAAGGGAGCAGCCCCAGTCAGG - Intergenic
1050141522 9:2521162-2521184 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1050300475 9:4253271-4253293 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1050369002 9:4901742-4901764 AAAAAGCAGCAGCCCCAGTCAGG - Intergenic
1050404521 9:5293557-5293579 AACAGGCAGCAGCCCCAGTCAGG + Intergenic
1050450876 9:5779978-5780000 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1050637439 9:7626987-7627009 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1050750584 9:8932529-8932551 GAAAGGCAGCAGCCACAGTCAGG - Intronic
1050852089 9:10300747-10300769 AAAAGGCAGCAGCCCAGGTGAGG + Intronic
1050943128 9:11485410-11485432 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1050973886 9:11912068-11912090 GAGAGGCAGAAGTCCCAGTCAGG - Intergenic
1051308838 9:15747230-15747252 AAAAGGCAGCAGCCTCATTCAGG + Intronic
1051321915 9:15914304-15914326 GAAAGGCAGCAGCCCCAGTGAGG - Intronic
1051329005 9:16003972-16003994 AAAAGGCTGCAGTCCCTGTGGGG - Intronic
1051353952 9:16223860-16223882 AAAAGGCAACAGCCCTAGTCAGG + Intronic
1051447432 9:17155424-17155446 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1051571458 9:18563670-18563692 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1051611616 9:18967404-18967426 GAAAGGCAACAGCCCCAGTCAGG - Intronic
1051670437 9:19504729-19504751 AAAAGACAGCAGCCCCAGTCAGG - Intergenic
1051863362 9:21651511-21651533 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1051940191 9:22496107-22496129 GAAAGGCAGCAGACCCAGTCAGG - Intergenic
1052061520 9:23966312-23966334 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1052134116 9:24889261-24889283 GAAAGGCAGCAGCCCCACTCAGG + Intergenic
1052241407 9:26277886-26277908 AAAAGGCAGCAGCCCCAGCCAGG + Intergenic
1052329421 9:27251979-27252001 AAAAGGCAGCAGCCCCAGTTAGG + Intergenic
1052336358 9:27324270-27324292 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1052382308 9:27784863-27784885 GAAAGGCCGCAGCCCCAGTCAGG - Intergenic
1052746639 9:32448201-32448223 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1052752772 9:32509082-32509104 AAAAGCCAGCAGCCCCACTCAGG + Intronic
1053608135 9:39681046-39681068 GAAAGGCAGCAGCCCTAGTCAGG - Intergenic
1053865976 9:42437406-42437428 GAAAGGCAGCAGCCCTAGTCAGG - Intergenic
1054245396 9:62661363-62661385 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
1054559525 9:66695894-66695916 GAAAGGCAGCAGCCCTAGTCAGG + Intergenic
1054889158 9:70232981-70233003 AAAAGGCAACAGCCCCAGTCAGG + Intergenic
1054985955 9:71262173-71262195 GAAAGGCAGCAGCCCCAGTCTGG - Intronic
1054995498 9:71383532-71383554 AAAAGGCAACAGCCCCTGTCAGG + Intronic
1055061456 9:72072983-72073005 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1055125684 9:72716419-72716441 AAAAGCCAGCAGCCCCAGTCAGG - Intronic
1055210350 9:73783531-73783553 GAAAGGGAGCAGTCCCAGTCAGG + Intergenic
1055239256 9:74163978-74164000 GAAAGGCAGTAGCCCCAGTCAGG + Intergenic
1055338943 9:75261614-75261636 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1055345019 9:75326804-75326826 CAAAGGCAGCAGTCCCAGTCAGG - Intergenic
1055386806 9:75771599-75771621 GAAAGGCAGCAGACCCAGTCAGG - Intergenic
1055494601 9:76841780-76841802 GAAAGGCAGCAACCCCAGTCAGG + Intronic
1055590483 9:77807961-77807983 AATAGGCAGCAGGCCAAATTTGG + Intronic
1055823859 9:80300936-80300958 GAAAGGCAGCAGCTCCAGTCAGG - Intergenic
1056003495 9:82242658-82242680 GAAAGGCAGCAACCCCAGTAAGG - Intergenic
1056123763 9:83514445-83514467 GAAAGGCAGCAGCTCCAGTCAGG + Intronic
1056302604 9:85257806-85257828 GAAAGGCAGCAGCCCCAATTAGG - Intergenic
1056320950 9:85433899-85433921 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1056997746 9:91479303-91479325 GAAAGGCAGCAGCCCCAATCAGG - Intergenic
1058029303 9:100177608-100177630 GAAAGGCAGAAGCCCCAGTCAGG + Intronic
1058034552 9:100237016-100237038 GAAAGGCAGCAGTTCCTGTCAGG - Intronic
1058093250 9:100829416-100829438 AAAAGACAGCAGCCCCAGTCAGG - Intergenic
1058265820 9:102897900-102897922 GAAAGACAGCAGCCCCAGTCAGG + Intergenic
1058408497 9:104703942-104703964 GAAAGGCAGCAGACCCAGTCAGG + Intergenic
1058559017 9:106203885-106203907 AAAAGACACCAGCCCCAGTCAGG - Intergenic
1059088884 9:111334774-111334796 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1059954623 9:119502658-119502680 GAAAGGCAGCAGGCCCAGTTAGG + Intronic
1060740948 9:126097172-126097194 AAAATGAAGCAGCCCCACTTTGG + Intergenic
1061272458 9:129550915-129550937 AAAAAAAAGCAGTCCCAGGTCGG + Intergenic
1185625644 X:1480008-1480030 AAAAGGCTCCAGGCCCAGATGGG + Intronic
1185911181 X:3982499-3982521 AAAAGGCAGCAACCCCAGTCAGG + Intergenic
1186181290 X:6975861-6975883 GAAAGGCAGCAGCCCAAGTCAGG - Intergenic
1186354236 X:8773422-8773444 AAAAGGCACCAGCCCCCGTCAGG + Intergenic
1186599771 X:11024451-11024473 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1186773281 X:12839015-12839037 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1186774821 X:12854426-12854448 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1186810367 X:13182091-13182113 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1186929166 X:14369690-14369712 GAGAGGCAGCAGCCCCAGTCAGG + Intergenic
1186960916 X:14735892-14735914 GAAAGGCAGCAGCCTCAGTCAGG - Intergenic
1187660890 X:21545401-21545423 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1187729029 X:22234426-22234448 AAAAGGCAACAGCCCCAGTCAGG - Intronic
1187729559 X:22238731-22238753 GAAAAGCAGCAGCCCCAGTCAGG + Intronic
1187784349 X:22867163-22867185 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1187839909 X:23476549-23476571 CAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1188084157 X:25882820-25882842 AGAAGGCAGCAGCCCCAGTCAGG + Intergenic
1188129985 X:26419422-26419444 GAAAGGCAGCAGCCCTAGTCAGG - Intergenic
1188193249 X:27197467-27197489 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1188201716 X:27300004-27300026 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1188561213 X:31470807-31470829 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1188915429 X:35904537-35904559 GAAATGCAGCAGCCCCAGTCAGG - Intergenic
1189039731 X:37530114-37530136 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1189210783 X:39280362-39280384 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1189243376 X:39542646-39542668 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
1189575071 X:42343029-42343051 GAAAGGCAGCAGCCACAGTCAGG - Intergenic
1189619057 X:42816334-42816356 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1189702585 X:43727329-43727351 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1189721831 X:43927450-43927472 GAAAGTCAGCAGCCCCAGTCAGG - Intergenic
1189937794 X:46087603-46087625 AAAAGGCAGCAGCCACAGTCAGG + Intergenic
1190341427 X:49299668-49299690 GAAAGGCAGCAGCCCCAGGCAGG - Intronic
1190495054 X:51020730-51020752 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1190505912 X:51125707-51125729 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1190959728 X:55234475-55234497 GAAAGGCAGCAGCCCCAGTCGGG - Intronic
1191005109 X:55702905-55702927 AAAAAGCAACAGCCCCAGTCAGG + Intergenic
1191039471 X:56063813-56063835 GAAAGACAGCAGCCCCAGTCAGG - Intergenic
1191071996 X:56410685-56410707 GAAAGGCAGCAGACCCAGTCAGG - Intergenic
1191098941 X:56704589-56704611 GAAAGGCAGAAGCCCCAGTCAGG - Intergenic
1191111984 X:56811412-56811434 AAAAGGCAGCAGTTCCAGTCAGG - Intergenic
1191115435 X:56847214-56847236 GAAAGGGAGCAGCCCCAGTCAGG + Intergenic
1191133262 X:57037691-57037713 GAAAGGTAGCAGCCCCAGTCAGG - Intergenic
1191138941 X:57095126-57095148 AAAAGGCAGCAGCCCCAGCCAGG + Intergenic
1191148082 X:57190061-57190083 GAAAGGCACCAGCCCCAGTCAGG - Intergenic
1191155798 X:57271311-57271333 AAAAGGTAGCAGCCCCAGTCAGG + Intergenic
1191172187 X:57459310-57459332 GAAAGGCAGCAGCCCCAGGCAGG + Intronic
1191186708 X:57620971-57620993 GAAAGGCAGTAGCCCCAGTCAGG + Intergenic
1191197928 X:57744601-57744623 CAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1191206741 X:57842565-57842587 AAAGGGCAGCAACCCCAGTCAGG + Intergenic
1191208130 X:57855468-57855490 GAAAGGCAGCAGCCCCATTCAGG + Intergenic
1191222381 X:58003227-58003249 AAAAAGCAGCAGCCCCAGTCAGG + Intergenic
1191591355 X:62888577-62888599 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1191606280 X:63066116-63066138 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1191631983 X:63331510-63331532 AAAAGGCAGGAGCCACAGTCAGG + Intergenic
1191676660 X:63798233-63798255 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1191686765 X:63899925-63899947 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1191705148 X:64086153-64086175 AAAAGGCAGCAGCCTCAGTTAGG + Intergenic
1191762597 X:64661857-64661879 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1191785028 X:64908066-64908088 AAAAAGCAGCAGCCCCAGTCAGG + Intergenic
1191787775 X:64935305-64935327 AAAAGGCAGGAGCCCCAGTCAGG + Intronic
1191788734 X:64945737-64945759 AAAAGGCAGCAGTCCCAGTTAGG - Intronic
1191793809 X:64999923-64999945 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1191795687 X:65019017-65019039 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1191799895 X:65066797-65066819 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1191824186 X:65346784-65346806 AAAAGGCAGCACCTCCAGTCAGG + Intergenic
1191824879 X:65353946-65353968 GAATGGCAGCAGCCCCAGTCAGG + Intergenic
1191848566 X:65568977-65568999 AAGAGGCAGCAGCCCCAGTCAGG - Intergenic
1191872911 X:65765036-65765058 ATAAGGCAGCAGCCCCAGTCAGG - Intergenic
1191908918 X:66126882-66126904 CAAATGCAGCAGTCCCAGTCAGG - Intergenic
1191928668 X:66344324-66344346 GAAAGGCAGCAGTCCGATTCAGG - Intergenic
1191931330 X:66376301-66376323 GAAAGGCAGAAGCCCCAGTTAGG - Intergenic
1191947784 X:66554275-66554297 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1191984872 X:66968957-66968979 AAGAGGCAACAGCCCCAGTCAGG + Intergenic
1192023836 X:67427016-67427038 GAAAGGCAGCAGTCCCAGTCAGG - Intergenic
1192030730 X:67509669-67509691 GAAAGGCAGAAGACCCAGTCAGG + Intergenic
1192064248 X:67864396-67864418 GAAAGACAGCAGCCCCAGTCAGG - Intergenic
1192128948 X:68530123-68530145 GAAAGTCAGCAGCCCCAGTCAGG - Intronic
1192228492 X:69246391-69246413 GAAAGGCAGCAGCTCCAGTCAGG + Intergenic
1192524575 X:71830428-71830450 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1192598582 X:72437824-72437846 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1192637156 X:72830786-72830808 AAAAGGCAGCATCCCCAGGCAGG - Intronic
1192644558 X:72890028-72890050 AAAAGGCAGCATCCCCAGGCAGG + Intronic
1192692151 X:73375149-73375171 GAAAGGCAGCAGCCCAAGTCAGG + Intergenic
1192694768 X:73401847-73401869 AAAAGGCAGCAGCTCCAGTCAGG + Intergenic
1192703139 X:73497697-73497719 AAAAGGCAGCAGCCCCATTCAGG - Intergenic
1192755800 X:74046260-74046282 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1192759165 X:74077729-74077751 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1192878621 X:75258605-75258627 GAAAGGCAGCAACCCCAGTCAGG + Intergenic
1192884239 X:75320210-75320232 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1192922713 X:75724254-75724276 AAAAGGTGGCAGCCCCAGTCAGG - Intergenic
1192931837 X:75814684-75814706 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1192933937 X:75838936-75838958 AAAAGGTAACAGCTCCAGTTAGG - Intergenic
1192953145 X:76039275-76039297 AAAAGGTAACAGCCCCAGTCAGG - Intergenic
1192958145 X:76095503-76095525 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1192964204 X:76159799-76159821 ACAAGGCAGCAGCCCCATTCAGG + Intergenic
1192966513 X:76182937-76182959 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1192977256 X:76299703-76299725 AAAAGACAGCAGCCCCAGTCAGG - Intergenic
1192984314 X:76380188-76380210 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1192992150 X:76471718-76471740 GAAAGGCAGCAGCCACAGTAAGG + Intergenic
1192999590 X:76550102-76550124 GAAAGGCAGCTGCCCCAGTTAGG - Intergenic
1193003621 X:76591085-76591107 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1193010674 X:76671516-76671538 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1193034510 X:76934709-76934731 GAAAGGCAGCAGCCCCTGTCAGG + Intergenic
1193040427 X:76998639-76998661 GAAAGGCAACAGCCCCAGTCAGG - Intergenic
1193068619 X:77283311-77283333 GAAAGGCAGGAGCCCCAGTCAGG + Intergenic
1193079381 X:77390683-77390705 GAAAGGCAGCAGTCCCAGTTAGG + Intergenic
1193081552 X:77411697-77411719 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1193113737 X:77756007-77756029 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1193161337 X:78232720-78232742 ATAAGGCAACAGCCCCAGTCAGG - Intergenic
1193228396 X:79013049-79013071 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1193241430 X:79174598-79174620 AAAAGTCAGCATTCCCATTATGG - Intergenic
1193253995 X:79325321-79325343 GAAAGGCAGCATTCCCAGTCAGG - Intergenic
1193266881 X:79482496-79482518 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1193284594 X:79696942-79696964 GAAAGGCAGCAGCACCAGTCAGG - Intergenic
1193334677 X:80274208-80274230 GAAAGGCAGCAGCCCCAGTAAGG + Intergenic
1193355961 X:80520853-80520875 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1193361671 X:80586532-80586554 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1193394507 X:80968085-80968107 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1193409358 X:81143981-81144003 AAAAGGCAGCCGCCCAAGTCAGG + Intronic
1193420186 X:81273619-81273641 AAAAGGCAAAATTCCCACTTTGG + Intronic
1193510048 X:82388560-82388582 GAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1193595070 X:83435657-83435679 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1193615966 X:83688555-83688577 GCAAGGCAGCAGCCCCAGTCAGG - Intergenic
1193645739 X:84066593-84066615 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1193646800 X:84079808-84079830 GAAAGGCAGCAGCCACAGTCAGG + Intronic
1193743088 X:85242404-85242426 AACAGGCAGCAGTCCAGATTTGG - Intergenic
1193878763 X:86896336-86896358 GAAAGGCATCAGCCCCAGTCAGG + Intergenic
1193897301 X:87129088-87129110 GAAAGGCAACAGCCCCAGTCAGG + Intergenic
1193906720 X:87253577-87253599 AAAAGGGAGCAGCCCCAGTTAGG - Intergenic
1193949360 X:87778895-87778917 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1194021287 X:88694997-88695019 GAAAGGCAGCAGCTCCAGTCAGG + Intergenic
1194098612 X:89674598-89674620 GAAAGGTAGCAGCCCCAGTCAGG + Intergenic
1194118956 X:89937395-89937417 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1194121793 X:89971722-89971744 AGAAGGCATCAGGCCCTGTTTGG + Intergenic
1194203548 X:90983791-90983813 GAAAGGCAGCAGCCCCACTCAGG + Intergenic
1194203584 X:90984013-90984035 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1194254670 X:91621986-91622008 AAAAGGCAGCAGCCTCAGTCAGG - Intergenic
1194315259 X:92369174-92369196 GAAAGGCAACAGCCCCAGTCAGG - Intronic
1194355815 X:92882455-92882477 GAAAGGCATCAGCCCCAGTCAGG + Intergenic
1194391202 X:93319917-93319939 AAAAGGCAGCAGCCCCAATCAGG + Intergenic
1194545179 X:95225431-95225453 GAAAGGCAGCAGCCCCACTCAGG + Intergenic
1194576322 X:95618577-95618599 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1194624809 X:96215011-96215033 GAAAGGCAGTAGACCCAGTCAGG + Intergenic
1194643365 X:96429220-96429242 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1194771832 X:97915734-97915756 GAAAGGCAGCAGCCGCAGTCAGG + Intergenic
1194783100 X:98049012-98049034 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1194798361 X:98240496-98240518 GAAAGGCAGCAGCCCTAGTGAGG - Intergenic
1194837439 X:98698769-98698791 GAAAGGTAGCAGCCCCAGTCAGG - Intergenic
1194901238 X:99514395-99514417 GAAAGGCAGCAGCCCCAGCCAGG + Intergenic
1194959038 X:100214430-100214452 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1195102333 X:101567340-101567362 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1195344921 X:103940314-103940336 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1195414256 X:104602809-104602831 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1195415095 X:104611315-104611337 AAAAGGCAGCAGCCCCAATCAGG - Intronic
1195425843 X:104729429-104729451 AAAAGGCAGCAGGCCCTATTTGG - Intronic
1195434664 X:104828786-104828808 GAAAGGCAACAGCCCCAGTCAGG - Intronic
1195435887 X:104843065-104843087 GAAATGCAGCAGCCCCAGTCAGG - Intronic
1195519216 X:105812105-105812127 GAGAGGCAGCAGCCCCAGTCAGG - Intergenic
1195580254 X:106493477-106493499 AAAAGGCAACAGCCCCAGTCAGG - Intergenic
1195730245 X:107959589-107959611 TAAAGGCAACAGCCCCAGTAAGG - Intergenic
1195774790 X:108391353-108391375 AAAAGGCAGCAGCCCCAGTCAGG - Intronic
1195810599 X:108824870-108824892 AGAAGGCAGCAGCCCCAGTCAGG - Intergenic
1195826207 X:109003827-109003849 GAAAGGCAGAAGCCCCAGTCAGG + Intergenic
1195842786 X:109192491-109192513 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1195889441 X:109676447-109676469 AAAAGGCAGCATTGCCTGGTGGG + Intronic
1195948220 X:110238530-110238552 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1195985603 X:110626799-110626821 AAAAGGCAGCAGCCTCAGTCAGG + Intergenic
1196133429 X:112181663-112181685 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1196281140 X:113825173-113825195 GAAAGGCAGCAGCACCAGTCAGG - Intergenic
1196308031 X:114127467-114127489 AAAAGGCAGTAGCCCCAGTCAGG - Intergenic
1196312415 X:114183965-114183987 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1196467084 X:115983468-115983490 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1196545693 X:116962234-116962256 CAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1196587238 X:117443922-117443944 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1196946561 X:120832719-120832741 GAAAGGCAGCAGCCCCACTCAGG - Intergenic
1196960189 X:120992709-120992731 GAAAGGCAGCATCCCCAGTCAGG - Intergenic
1197004052 X:121474542-121474564 AAAAGGCAGCAGCCCACGTCAGG - Intergenic
1197142229 X:123130128-123130150 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1197157258 X:123283729-123283751 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1197191123 X:123648797-123648819 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1197350103 X:125372411-125372433 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1197395565 X:125922991-125923013 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1197614274 X:128674681-128674703 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1197847083 X:130814226-130814248 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1197880724 X:131164068-131164090 GAAAGACAGCAGCCCCAGTCAGG - Intergenic
1197906286 X:131428747-131428769 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1197926960 X:131656699-131656721 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1198002238 X:132451327-132451349 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1198072140 X:133159524-133159546 AAAAGGCAGCAGCCCCATTCAGG + Intergenic
1198085657 X:133279414-133279436 CAAAGGCAGCAGCCCCATTCAGG + Intergenic
1198259286 X:134951563-134951585 AAAAGGCAGTAGCCCCAGTCAGG + Intergenic
1198295360 X:135282148-135282170 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1198519028 X:137433862-137433884 GAAAGGCAACAGCCCCAGTCAGG + Intergenic
1198555844 X:137792515-137792537 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
1198645466 X:138801741-138801763 GAAAGGCAGTAGCCCCAGTCAGG - Intronic
1198663505 X:138996661-138996683 AAAAGGCAGCAGCCCCAGTCAGG + Intronic
1198753576 X:139959397-139959419 GAAAGGCAACAGCCCCAGTCAGG + Intronic
1198758046 X:140001363-140001385 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1198911917 X:141624558-141624580 AGCAGGTAGCAGTGCCAGTTAGG - Intronic
1199004092 X:142675035-142675057 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1199094503 X:143723958-143723980 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1199469787 X:148181699-148181721 GAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1199801250 X:151253197-151253219 GAAATGCAGCAGCCCCAGTCAGG + Intergenic
1199830723 X:151546536-151546558 GAAAGGCAGTAGCCCCAGTCAGG + Intergenic
1200223277 X:154402672-154402694 AAAAGGCAGCAGGCCCTGGGGGG + Exonic
1200301673 X:154982604-154982626 ACATGGCACCATTCCCAGTTGGG + Intronic
1200333257 X:155320041-155320063 GAAAGGCAGCAGCCCCAGTCAGG + Intronic
1200407637 Y:2829760-2829782 AAAAGGCAAGAGCCCCAGTCAGG + Intergenic
1200471832 Y:3594949-3594971 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1200549378 Y:4559230-4559252 GAAAGGCAGCAGCCCCACTCAGG + Intergenic
1200549414 Y:4559452-4559474 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1200573456 Y:4861589-4861611 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1200623310 Y:5480709-5480731 GAAAGGCAACAGCCCCAGTCAGG - Intronic
1200664162 Y:5999436-5999458 GAAAGGCATCAGCCCCAGTCAGG + Intergenic
1200777510 Y:7182652-7182674 AAAAGGAAGTCATCCCAGTTAGG - Intergenic
1201230989 Y:11864064-11864086 AAAAGGCAGCAGCTGCATTTAGG - Intergenic
1201312847 Y:12612507-12612529 GAAAGGCAGCAGTCCCAGTCAGG + Intergenic
1201394731 Y:13536500-13536522 AAAAGGCAGCAGCCACATTAGGG - Intergenic
1201406131 Y:13652214-13652236 AAAAAGCAGCAGCCACAGTCAGG - Intergenic
1201422262 Y:13812366-13812388 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1201493134 Y:14564599-14564621 AAAAGGCAGTAGCCCCAGTCAGG + Intronic
1201498200 Y:14612951-14612973 GAAAGGCAGCAGCACCAGTTAGG - Intronic
1201498645 Y:14617756-14617778 GAAAGGCAGCAGCACCAGTCAGG - Intronic
1201511579 Y:14770033-14770055 AGAAGGCAGCAACCCCAGTCAGG + Intronic
1201541553 Y:15110470-15110492 AAAAGGCTGCAGCCCCAGTCAGG - Intergenic
1201563564 Y:15343522-15343544 GAAAGGCAGCAGCCCCAGGCAGG - Intergenic
1201591261 Y:15617273-15617295 AAAATGCAGCAGCCCCAGTCAGG + Intergenic
1201608735 Y:15816582-15816604 GAAAGGCAGCATCTCCAGTTAGG + Intergenic
1201651646 Y:16295098-16295120 GGAAGGCAGCAGCCCCAGTCAGG + Intergenic
1201689971 Y:16752674-16752696 GAAAAGCAGCAGGCCCAGTAAGG - Intergenic
1201705136 Y:16928476-16928498 AAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1201850903 Y:18478672-18478694 GAATGGCAGCAGCCCCAGTTAGG - Intergenic
1201854085 Y:18521479-18521501 GAAAGGCAGCAGCCCCAGTCAGG + Intergenic
1201879236 Y:18798905-18798927 GAAAGGCAGCAGCCCCAGTCAGG - Intronic
1201882416 Y:18841706-18841728 GAATGGCAGCAGCCCCAGTTAGG + Intergenic
1201961898 Y:19690137-19690159 AAAAGGCAGCAGTGCCAGTCAGG - Intergenic
1201979323 Y:19890622-19890644 AAAAGGCAGAAGCCCCAGTCAGG - Intergenic
1201992509 Y:20043041-20043063 AAAAGGCAGCAGCCCCAGTCAGG - Intergenic
1202266872 Y:23028850-23028872 AAAAGGCAGAACTGCCAGCTTGG - Intergenic
1202330643 Y:23749042-23749064 GAATGGCAGCAGCCCCAGTAAGG + Intergenic
1202335207 Y:23801486-23801508 AAATGGCAGTAGCCCCAGTCAGG + Intergenic
1202342236 Y:23881965-23881987 GAATGGCAGCAGCCCCAGTCAGG - Intergenic
1202347941 Y:23954749-23954771 GAATGGCAGCAGCCCCAGTTAGG + Intergenic
1202419865 Y:24662595-24662617 AAAAGGCAGAACTGCCAGCTTGG - Intergenic
1202450921 Y:25007489-25007511 AAAAGGCAGAACTGCCAGCTTGG + Intergenic
1202522833 Y:25715355-25715377 GAATGGCAGCAGCCCCAGTTAGG - Intergenic
1202528533 Y:25788120-25788142 GAATGGCAGCAGCCCCAGTCAGG + Intergenic
1202535560 Y:25868573-25868595 AAATGGCAGTAGCCCCAGTCAGG - Intergenic
1202540126 Y:25921019-25921041 GAATGGCAGCAGCCCCAGTAAGG - Intergenic