ID: 1065121825

View in Genome Browser
Species Human (GRCh38)
Location 10:22537979-22538001
Sequence CCCCTGCAGAAGCACGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065121816_1065121825 13 Left 1065121816 10:22537943-22537965 CCTTTCTGAGCCCTGCAGAGAGC 0: 1
1: 0
2: 1
3: 25
4: 294
Right 1065121825 10:22537979-22538001 CCCCTGCAGAAGCACGGTGAGGG No data
1065121815_1065121825 14 Left 1065121815 10:22537942-22537964 CCCTTTCTGAGCCCTGCAGAGAG 0: 1
1: 0
2: 1
3: 29
4: 272
Right 1065121825 10:22537979-22538001 CCCCTGCAGAAGCACGGTGAGGG No data
1065121818_1065121825 2 Left 1065121818 10:22537954-22537976 CCTGCAGAGAGCAAGCAAGCCTG 0: 1
1: 0
2: 2
3: 21
4: 224
Right 1065121825 10:22537979-22538001 CCCCTGCAGAAGCACGGTGAGGG No data
1065121813_1065121825 23 Left 1065121813 10:22537933-22537955 CCACTGTTCCCCTTTCTGAGCCC 0: 1
1: 0
2: 3
3: 50
4: 422
Right 1065121825 10:22537979-22538001 CCCCTGCAGAAGCACGGTGAGGG No data
1065121814_1065121825 15 Left 1065121814 10:22537941-22537963 CCCCTTTCTGAGCCCTGCAGAGA 0: 1
1: 0
2: 3
3: 29
4: 298
Right 1065121825 10:22537979-22538001 CCCCTGCAGAAGCACGGTGAGGG No data
1065121817_1065121825 3 Left 1065121817 10:22537953-22537975 CCCTGCAGAGAGCAAGCAAGCCT 0: 1
1: 0
2: 1
3: 21
4: 227
Right 1065121825 10:22537979-22538001 CCCCTGCAGAAGCACGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065121825 Original CRISPR CCCCTGCAGAAGCACGGTGA GGG Intronic
No off target data available for this crispr