ID: 1065124329

View in Genome Browser
Species Human (GRCh38)
Location 10:22559720-22559742
Sequence CAGGCCAGGACTTCTCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065124325_1065124329 18 Left 1065124325 10:22559679-22559701 CCTTAATCTATATCTGGAATAGA 0: 1
1: 0
2: 1
3: 13
4: 180
Right 1065124329 10:22559720-22559742 CAGGCCAGGACTTCTCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065124329 Original CRISPR CAGGCCAGGACTTCTCCAAG TGG Intronic
No off target data available for this crispr