ID: 1065124418

View in Genome Browser
Species Human (GRCh38)
Location 10:22560293-22560315
Sequence AGCACAGCAGCGTATCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 300}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065124418_1065124419 -7 Left 1065124418 10:22560293-22560315 CCAGAAGGATACGCTGCTGTGCT 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1065124419 10:22560309-22560331 CTGTGCTTTTGTGTCACGTTTGG No data
1065124418_1065124427 27 Left 1065124418 10:22560293-22560315 CCAGAAGGATACGCTGCTGTGCT 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1065124427 10:22560343-22560365 CCCTGGCCACCTCACTTCAATGG No data
1065124418_1065124420 -6 Left 1065124418 10:22560293-22560315 CCAGAAGGATACGCTGCTGTGCT 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1065124420 10:22560310-22560332 TGTGCTTTTGTGTCACGTTTGGG No data
1065124418_1065124421 -5 Left 1065124418 10:22560293-22560315 CCAGAAGGATACGCTGCTGTGCT 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1065124421 10:22560311-22560333 GTGCTTTTGTGTCACGTTTGGGG No data
1065124418_1065124422 10 Left 1065124418 10:22560293-22560315 CCAGAAGGATACGCTGCTGTGCT 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1065124422 10:22560326-22560348 GTTTGGGGAGCCCGCCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065124418 Original CRISPR AGCACAGCAGCGTATCCTTC TGG (reversed) Intronic
901045242 1:6392423-6392445 AGAACTGCAGAGTAACCTTCAGG + Intronic
902678276 1:18024490-18024512 AGCATAGCAGCATTTGCTTCTGG + Intergenic
902801246 1:18831539-18831561 AGCATAGAAGCGTCTGCTTCTGG - Intergenic
903026605 1:20433887-20433909 AGCACAGCAGCTTCTGCCTCTGG - Intergenic
904060373 1:27705004-27705026 AGCACAGCAGCATCTGCTTCTGG + Intergenic
904813863 1:33181399-33181421 AGCACAGCAGCTCGTCCTTGAGG + Exonic
905165773 1:36082321-36082343 AGCACAGCAGAGTGTCCTCTGGG + Intergenic
905648967 1:39643923-39643945 AGCACAGTAGCATCTGCTTCTGG - Intergenic
906893562 1:49744387-49744409 AGCATAGCGGCTTCTCCTTCTGG - Intronic
908929825 1:69305091-69305113 AGCATAGCAGCATCTGCTTCTGG - Intergenic
909768436 1:79388142-79388164 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
911202020 1:95054439-95054461 AGCATAGCAGCTTTTGCTTCTGG - Intronic
911762057 1:101627625-101627647 AGCATAGCAGCGTCTGCTTCTGG - Intergenic
911863163 1:102981112-102981134 AGCTTAGCAGTGCATCCTTCAGG - Intronic
912313607 1:108646839-108646861 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
912417180 1:109517513-109517535 AGCACAGCAGCATCTGCTTCCGG + Intergenic
913377384 1:118168029-118168051 AGCACAGCAGCTTCTGCTTCTGG - Intronic
915694263 1:157722986-157723008 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
917209598 1:172617952-172617974 AGCACAACAGAGTATTCTTGGGG + Intergenic
917663124 1:177197159-177197181 AGCACAGCGGCTTCTGCTTCTGG + Intronic
918440209 1:184559365-184559387 AGCACAGCTGCATCTGCTTCTGG - Intronic
918660712 1:187084546-187084568 AACACAGCAGAGAATCCTTTAGG - Intergenic
921301420 1:213754653-213754675 AGCACGGCAGCATCTGCTTCTGG - Intergenic
1064338168 10:14462653-14462675 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1065124418 10:22560293-22560315 AGCACAGCAGCGTATCCTTCTGG - Intronic
1066223856 10:33362167-33362189 AGCACAGCAGCTTCTGCTTTTGG - Intergenic
1066247503 10:33597530-33597552 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1067798784 10:49342129-49342151 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1069336764 10:67360621-67360643 AGCATAGCAGCTTCTGCTTCTGG + Intronic
1070385243 10:75918346-75918368 AGCATAGCAGCATCTGCTTCTGG + Intronic
1071053945 10:81487089-81487111 AAAACAGCAGCGTCTGCTTCTGG + Intergenic
1071660194 10:87493270-87493292 AGCATAGCAGCATCTGCTTCCGG + Intergenic
1071702519 10:87955503-87955525 AGCATAGCAGCATCTGCTTCTGG + Intronic
1074011750 10:109489481-109489503 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1074543077 10:114382312-114382334 AACACAGCAGCATATCTATCAGG + Intronic
1075673799 10:124282096-124282118 AGCATAGCAGCATCTGCTTCTGG + Intergenic
1076191303 10:128485407-128485429 AGCACGGCAGCCTCTGCTTCTGG + Intergenic
1077135074 11:994406-994428 AGGACAGCAGCGTGTCCAGCAGG - Intronic
1077400066 11:2350738-2350760 AGCACAGCAGCATCTGCTTCTGG - Intergenic
1077654559 11:4006311-4006333 AGCATAGCAGCTTCTGCTTCTGG - Intronic
1078824835 11:14919380-14919402 AGCATAGCAGCTTCTGCTTCGGG - Intronic
1079175209 11:18133679-18133701 AGCATAGCAGCTTCTGCTTCTGG - Intronic
1079264227 11:18914882-18914904 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1079268633 11:18960510-18960532 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1079519906 11:21314097-21314119 AGCACAGCAGCATCTGCTCCTGG - Intronic
1080306556 11:30843431-30843453 AGCATAGCAGCATCTGCTTCTGG + Intronic
1080967676 11:37232430-37232452 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1081024805 11:37998169-37998191 AGCATGGCAGCATCTCCTTCTGG + Intergenic
1081036923 11:38159711-38159733 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1081262103 11:40973107-40973129 AGCATAGCAGCTTCTGCTTCTGG - Intronic
1082628486 11:55513557-55513579 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1084233658 11:67771596-67771618 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1084446690 11:69207708-69207730 ATCACAGCAGCGCCTCCCTCCGG - Intergenic
1085239586 11:75041341-75041363 AGAACAGCAGCGTAACCTGCTGG + Intergenic
1086344680 11:85884047-85884069 AGCACAGCTGAGCATCCTTTGGG - Intronic
1088090897 11:106038142-106038164 AGCACAGCAGCATCTGCTTCTGG - Intergenic
1089746055 11:120617789-120617811 AGCACAGCAGCATCTGCTTCTGG - Intronic
1090585317 11:128205896-128205918 AGCACAGCAGCTTCTGCTTCTGG + Intergenic
1090854590 11:130600603-130600625 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1090874260 11:130774884-130774906 AGCACTGCAGTGAATCCTCCAGG - Intergenic
1091866732 12:3844663-3844685 AGCAAATCAGTGTTTCCTTCAGG - Intronic
1092473277 12:8796918-8796940 AGCATAGCAGCATCTGCTTCTGG + Intergenic
1092563432 12:9640234-9640256 AGCACAGCAAGGTATCCTTAAGG - Intergenic
1092670670 12:10857191-10857213 AGCATAGAAGCATATGCTTCTGG - Intronic
1092786217 12:12029293-12029315 AGCATAGCAGCATCTGCTTCTGG - Intergenic
1093535415 12:20217442-20217464 AGCACAGCAGCTTCTGCTTCTGG - Intergenic
1093546967 12:20360008-20360030 AGCAGAGCAGCTTTTACTTCTGG + Intergenic
1095388758 12:41680146-41680168 AGCATAGCAGCATCTGCTTCTGG - Intergenic
1095401380 12:41818165-41818187 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1095727945 12:45473048-45473070 AGCACAGCAGCATCTGCTTCTGG - Intergenic
1098088465 12:66874543-66874565 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1098357851 12:69627812-69627834 AGCACAGTGGCTTCTCCTTCTGG - Intergenic
1099727481 12:86451323-86451345 AACACAGTAGCCTCTCCTTCTGG - Intronic
1099854768 12:88150140-88150162 AGCATAGCAGCATCTGCTTCTGG + Intronic
1100278057 12:93090088-93090110 AGCATAGCAGCTTTTGCTTCTGG - Intergenic
1101690650 12:107076966-107076988 AGCATAGCAGCGTCTGCTTTTGG - Intronic
1102173706 12:110860952-110860974 AGCATAGCAGCTTCTGCTTCTGG + Intronic
1104447957 12:128848153-128848175 AGCACTGCAGCTTCTGCTTCTGG + Intergenic
1104755281 12:131265319-131265341 AGCACGGCAGCTTCTGCTTCTGG + Intergenic
1106463439 13:29992371-29992393 AGCATAGCAGCCTCTGCTTCTGG - Intergenic
1109093140 13:58073409-58073431 AGCATAGCAGCATCTGCTTCTGG - Intergenic
1109503220 13:63266304-63266326 AGCACAGCAGAATCTGCTTCTGG + Intergenic
1110033995 13:70655158-70655180 AGCATAGCACCTTATGCTTCTGG - Intergenic
1110763550 13:79256049-79256071 AGCACAGCAGCATCCGCTTCTGG - Intergenic
1111442828 13:88303446-88303468 AGCATAGCAGCTTCTTCTTCTGG - Intergenic
1112549101 13:100403417-100403439 AGCATAGCAGCATCTGCTTCTGG + Intronic
1113029471 13:105977332-105977354 AGCATAGCAGCGTCTGCTTCTGG - Intergenic
1114073256 14:19132022-19132044 AGGATACCAGCGTCTCCTTCGGG - Intergenic
1114089010 14:19267961-19267983 AGGATACCAGCGTCTCCTTCAGG + Intergenic
1115303572 14:31912274-31912296 AACACAGCAGCATCTGCTTCTGG - Intergenic
1117881719 14:60319143-60319165 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1118145342 14:63128607-63128629 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1119025930 14:71152177-71152199 AGCAAAGCAGCTTCTGCTTCTGG - Intergenic
1119611725 14:76069100-76069122 AGCACAGCAGCATCTGCTTCTGG + Intronic
1120032866 14:79662660-79662682 AGCATAGCAGCATCTGCTTCTGG + Intronic
1120461396 14:84801431-84801453 GCCACAGAAGTGTATCCTTCAGG + Intergenic
1125490619 15:40146002-40146024 ATCCCAGTAGCGTATTCTTCTGG - Intergenic
1126562829 15:50062404-50062426 AGCATAGCAGCATCTGCTTCTGG - Intronic
1127398694 15:58564343-58564365 AACACAGCAGCATTTCTTTCGGG - Intronic
1127940877 15:63694526-63694548 AGCCCAGCAACGTCTGCTTCTGG - Exonic
1127969650 15:63948337-63948359 AGCATAGCAGCTTTTGCTTCTGG + Intronic
1129636546 15:77324615-77324637 AGCACAGCAGCATCTGGTTCTGG + Intronic
1130603418 15:85293845-85293867 AGCACAGCGGCTTCTGCTTCTGG + Intergenic
1130664311 15:85856643-85856665 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1131463992 15:92639847-92639869 AGCATAGCAGCTTCTGCTTCTGG - Intronic
1131678135 15:94692484-94692506 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1132930270 16:2455464-2455486 TGCCCAGCAGCGTCTCCTCCTGG - Exonic
1133724649 16:8526202-8526224 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1133724689 16:8526645-8526667 AGCACAGCAGCTTCTGCTTCTGG - Intergenic
1134360141 16:13523512-13523534 AGCATAGCAGCATCTGCTTCTGG + Intergenic
1134627130 16:15730163-15730185 AGCATAGCAGCTTCTGCTTCTGG - Intronic
1135503069 16:23013852-23013874 AGCATAGCAGCATCTGCTTCTGG - Intergenic
1137382901 16:48015105-48015127 AGCACGGCAGCATCTTCTTCTGG + Intergenic
1140583259 16:76255603-76255625 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1141696938 16:85624613-85624635 AGGACAGCTGGGTTTCCTTCCGG + Intronic
1141943203 16:87292311-87292333 AGCTCGGCAGCGGATCCTTTAGG - Intronic
1143861591 17:9895204-9895226 AGCAGAGCAGTACATCCTTCTGG + Intergenic
1144043214 17:11431161-11431183 AGCCCAGCAGCTTGTTCTTCTGG + Intronic
1144160707 17:12554879-12554901 AGCACAGGAGCGAATCCTTCAGG + Intergenic
1144216158 17:13057488-13057510 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1144565406 17:16355047-16355069 AGCACACCAGAGTTTCCCTCAGG + Intergenic
1145165672 17:20611956-20611978 AGCATGGCAGCTTCTCCTTCTGG + Intergenic
1146594292 17:34156022-34156044 AGTAGAGCATCATATCCTTCAGG + Intronic
1147491829 17:40876331-40876353 ACCTCAGCAGCATCTCCTTCTGG + Exonic
1147539887 17:41348503-41348525 GGCACAGCAGCTCCTCCTTCAGG + Exonic
1150822851 17:68449707-68449729 AGCACGGCAGCATCTGCTTCTGG - Intronic
1150961061 17:69912768-69912790 AGCTAAGCAGCGTATCTTTCTGG + Intergenic
1151905244 17:77043814-77043836 AGCATGGCAGCGTCTGCTTCTGG + Intergenic
1152392991 17:80013706-80013728 ACCACAGGAGCGTGTCCTGCTGG + Intronic
1152548250 17:81013944-81013966 AGCACAGCGGCATCTGCTTCTGG - Intergenic
1152821234 17:82438918-82438940 AGAGCAGCGGCGCATCCTTCAGG + Intronic
1153574061 18:6503212-6503234 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1153588108 18:6644865-6644887 AGCATAGCAGCATCTGCTTCTGG + Intergenic
1155317688 18:24588937-24588959 GGCATAGCAGCTTCTCCTTCTGG - Intergenic
1158682922 18:59584752-59584774 AGCATAGCAGCTTCTGCTTCTGG - Intronic
1159493489 18:69168931-69168953 AGCATAGCAGCCTCTGCTTCTGG - Intergenic
1159563945 18:70026536-70026558 AGCACAGTGGCGTCTGCTTCTGG - Intronic
1159763158 18:72453766-72453788 AGCATAGCAGCATCTGCTTCTGG - Intergenic
1160249668 18:77190605-77190627 AGCACAGCAGTTTGTACTTCTGG - Intergenic
1161102739 19:2429334-2429356 AGCACAGCGGCGTAGCCTCCAGG + Exonic
1161908723 19:7176718-7176740 AGCATAGCAGCTTCTGCTTCTGG - Intronic
1165194836 19:34093832-34093854 AGCATAGCAGCCTCTGCTTCTGG + Intergenic
1166033519 19:40150624-40150646 AGCATGGCAGCGTCTGCTTCTGG - Intergenic
1166146480 19:40840306-40840328 AGCACAGCAGCTTCTGCTTCTGG - Intronic
1166150526 19:40870919-40870941 AGCATAGCAGCTTCTGCTTCTGG - Intronic
1166704520 19:44901248-44901270 AGGACACCAGCGTCTCCTTCGGG + Exonic
1167758913 19:51431082-51431104 AGCATAGCAGCCTCTGCTTCTGG - Intergenic
927311742 2:21639360-21639382 AGCATAGCAGCATCTGCTTCTGG + Intergenic
928613648 2:33015747-33015769 AGCATAGCAGCTTGTGCTTCTGG + Intronic
928619832 2:33077418-33077440 AGCACGGCAGCATCTGCTTCTGG + Intronic
928685612 2:33745905-33745927 AGCACAGCAGCATCTGCTCCTGG - Intergenic
931267293 2:60671852-60671874 AGCACATAAGCATTTCCTTCAGG - Intergenic
933870456 2:86560765-86560787 AGCACAGCAGCTTCTGCTTTTGG + Intronic
934050717 2:88208470-88208492 AACACAGCAGCATCTGCTTCTGG + Intergenic
934926535 2:98385762-98385784 AGCATAGCAGCTTCTGCTTCTGG + Intronic
934971457 2:98767798-98767820 AACACAGCAGAGCATCCTTGTGG + Intergenic
935065472 2:99643601-99643623 AGCACAGAAGTGTACCTTTCTGG - Intronic
936085508 2:109465682-109465704 AGCATAGCAGCTTTTACTTCTGG + Intronic
936732394 2:115399939-115399961 AGCATAGCAGCTTCTGCTTCTGG + Intronic
936777561 2:115992835-115992857 AGCATAGCAGCATCTGCTTCTGG - Intergenic
937050312 2:118883050-118883072 AGTTCAGCAGCGTTTCCTCCAGG + Intergenic
937690584 2:124750554-124750576 TGCACAGCAGACTATCCGTCTGG - Intronic
938017496 2:127879453-127879475 AGCATAGCAGCATCTGCTTCTGG - Intronic
938218656 2:129546148-129546170 AGCATAGCAGCATCTGCTTCTGG + Intergenic
938245740 2:129776480-129776502 ATCTCAGCAGCATATCCATCTGG + Intergenic
938487180 2:131723374-131723396 AGGACACCAGCGTCTCCTTCGGG - Intronic
938825465 2:135000742-135000764 AGCAGAGAGGCGTGTCCTTCCGG + Intronic
940507202 2:154570844-154570866 AGCATAGCAGCATCTGCTTCTGG - Intergenic
940887287 2:159000732-159000754 ACCACAGCCTCCTATCCTTCCGG - Intronic
941903282 2:170697674-170697696 TGCACATCAGGGTTTCCTTCTGG - Intergenic
942731765 2:179067682-179067704 AGCATAGCAGCATCTGCTTCTGG - Intergenic
945195399 2:207232730-207232752 AGCACAGAAGCGAGTCCTACTGG - Intergenic
946799073 2:223390597-223390619 AGCATAGCAGCATCTGCTTCTGG + Intergenic
947318069 2:228885439-228885461 AGCATAGCAGCTTGTGCTTCTGG + Intronic
947796332 2:232896369-232896391 AGCTCTGCAGAGGATCCTTCTGG - Intronic
1169073207 20:2746342-2746364 TGCACTGCAGGGTATCCTGCAGG + Intronic
1169415855 20:5415689-5415711 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1169504875 20:6198764-6198786 AGCACAGCAGCATCTGCTCCTGG + Intergenic
1169509591 20:6249331-6249353 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1170456634 20:16539640-16539662 AGCATAGCAGCATCTGCTTCTGG - Intronic
1170638273 20:18128659-18128681 AGCATAGCAGCATCTGCTTCTGG + Intergenic
1175840911 20:62026700-62026722 AGCAGAGCTGCTGATCCTTCAGG - Intronic
1180491697 22:15854375-15854397 AGGATACCAGCGTCTCCTTCGGG - Intergenic
1182862197 22:33569779-33569801 AGCACAGCATGTTATCCTGCTGG + Intronic
1184529684 22:45047079-45047101 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1184571694 22:45328873-45328895 AGCATAGCAGCATCTGCTTCCGG + Intronic
1184956417 22:47889801-47889823 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1185160999 22:49229798-49229820 AGTAAAGCAGCGTCTTCTTCTGG - Intergenic
949703869 3:6792631-6792653 AGCACAGCAGCATCTGCTTCTGG - Intronic
950696723 3:14706473-14706495 AGCACAGCACCCTAGCCTGCAGG + Intronic
950732447 3:14972730-14972752 AGCACGGCAGCATCTGCTTCTGG + Intronic
950741392 3:15054986-15055008 AGCACAGCAGCTTCTGCTTCTGG + Intronic
951087532 3:18531177-18531199 AGCATGGCAGCATCTCCTTCTGG - Intergenic
952420210 3:33123537-33123559 AGCATAGCAGCTTCTGCTTCTGG - Intronic
953196001 3:40734028-40734050 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
954322328 3:49840597-49840619 AGCACAGCTGCTTTTACTTCTGG - Intronic
954589345 3:51768079-51768101 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
955682327 3:61514997-61515019 AGCATAGCAGCCTCTGCTTCTGG - Intergenic
956552860 3:70481182-70481204 AGCATAGCAGCTTCTCCTTCTGG + Intergenic
959037634 3:101384858-101384880 AGCATAGCAGCATCTGCTTCTGG - Intronic
959839665 3:110959817-110959839 TGCCCAGCAGCGTCTACTTCAGG - Intergenic
960156207 3:114299427-114299449 TGAACAGCAGAGTATCCATCTGG - Intronic
963960873 3:151307385-151307407 AGCACAGCAGCCCTTCATTCAGG + Intronic
964436334 3:156657946-156657968 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
964528670 3:157643775-157643797 AGCATAGCAGCATCTGCTTCTGG + Intronic
965948078 3:174267233-174267255 ATCACAGCAGCATCTACTTCTGG + Intronic
966097775 3:176227226-176227248 AGTACAGCAGCTTCTGCTTCGGG - Intergenic
967548943 3:190766897-190766919 AGCACAGCAGCATCTGCTTCTGG + Intergenic
967656258 3:192053502-192053524 AGCATAGCAGCATTTACTTCTGG + Intergenic
968407195 4:351177-351199 AGCACAGCAGCTTCTACTTTTGG - Intronic
969821489 4:9724158-9724180 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
970412687 4:15824949-15824971 AGCCTAGCAGCGTGTCCTCCAGG - Exonic
970945088 4:21681748-21681770 AGCACAGCAGCATCTGCTTCTGG + Intronic
971568938 4:28184981-28185003 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
972227103 4:37026217-37026239 AGCATAGCAGCTTCTGCTTCCGG + Intergenic
974670269 4:65021483-65021505 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
976982863 4:91253750-91253772 AGCATAGCAGCTTCTGCTTCTGG + Intronic
977949987 4:102959688-102959710 AGCACAGGGGAGTGTCCTTCTGG - Intronic
978024995 4:103862559-103862581 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
978178074 4:105758561-105758583 AGCACAGCAGCATCTGCCTCTGG - Intronic
978981660 4:114954988-114955010 AGCATAGCAGCTTCTGCTTCTGG - Intronic
978990655 4:115078201-115078223 AGCATAGCAGCTTCTGCTTCTGG + Intronic
981471030 4:145135247-145135269 AGCAAATCAGTGTTTCCTTCAGG + Exonic
982207798 4:153010283-153010305 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
982666538 4:158271132-158271154 ACCACAGCAGCATCTGCTTCTGG - Intergenic
983154500 4:164329629-164329651 AGCACAGCAGCATCTGCTTATGG + Intronic
983631473 4:169853569-169853591 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
984867246 4:184291977-184291999 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
985060380 4:186072170-186072192 AGCATAGCAGCCTCTGCTTCTGG + Intronic
987639828 5:20598606-20598628 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
987675363 5:21066258-21066280 AGCACAGCAGCACCTGCTTCTGG - Intergenic
987693784 5:21302130-21302152 AGCATAGCAGCATCTGCTTCTGG + Intergenic
987711771 5:21510196-21510218 AGCACAGCGGCATCTTCTTCTGG + Intergenic
990498334 5:56370535-56370557 AGCATGGCAGCGTCTGCTTCCGG - Intergenic
991659515 5:68935936-68935958 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
991746473 5:69747409-69747431 AGCATAGCAGCATCTGCTTCTGG - Intergenic
991751232 5:69807832-69807854 AGCATAGCAGCATCTGCTTCTGG + Intergenic
991798074 5:70327354-70327376 AGCATAGCAGCATCTGCTTCTGG - Intergenic
991825851 5:70622723-70622745 AGCATAGCAGCATCTGCTTCTGG - Intergenic
991830520 5:70682726-70682748 AGCATAGCAGCATCTGCTTCTGG + Intergenic
991890414 5:71326676-71326698 AGCATAGCAGCATCTGCTTCTGG - Intergenic
996723569 5:126653591-126653613 AGCATAGCAGCTTCTTCTTCTGG + Intergenic
998442419 5:142173732-142173754 AGCATAGCAGCCTCTGCTTCTGG + Intergenic
998824541 5:146087793-146087815 AGCATAGCAGCTTCTGCTTCTGG + Intronic
999571443 5:152924407-152924429 AGCATAGCAGCATCTGCTTCTGG - Intergenic
999971592 5:156869184-156869206 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1000243414 5:159429356-159429378 AGCAAAGCAGCTTCTGCTTCTGG + Intergenic
1002002542 5:176206189-176206211 AGCACAGCAGCTTCTGCTTCTGG + Intergenic
1002224058 5:177705423-177705445 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1003398549 6:5773226-5773248 AGCACGGCAGCTTCTGCTTCTGG - Intergenic
1005483498 6:26277048-26277070 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1005557125 6:26997807-26997829 AGCATAGCAGCATCTGCTTCTGG - Intergenic
1005984872 6:30865256-30865278 AGCATAGCAGCATCTCTTTCTGG + Intergenic
1006224660 6:32527111-32527133 AGCACAGCAGGGAATCCTCAGGG - Intronic
1006231028 6:32586993-32587015 AGCACAGCAGGGAATTCTTCAGG - Intronic
1007360966 6:41355322-41355344 AGCATAGCAGCTTCTACTTCTGG - Intergenic
1007361693 6:41361280-41361302 AGCATGGCAGCGTCTGCTTCTGG - Intergenic
1007975119 6:46093953-46093975 AGCATAGCAGCATCTGCTTCTGG + Intergenic
1011157063 6:84344554-84344576 AGCATAGCAGCATCTGCTTCTGG - Intergenic
1012046378 6:94279939-94279961 AGCATAGCAACTTCTCCTTCTGG - Intergenic
1012411811 6:98967041-98967063 AGCAGAGCACCGTGTCCCTCTGG + Intergenic
1012525217 6:100169393-100169415 GACACAGCAGCTTATCCTTCAGG + Intergenic
1012838876 6:104304513-104304535 AGCTCAGAAGTATATCCTTCTGG + Intergenic
1014415413 6:121177426-121177448 AGCATAGCAGCTTCTGCTTCTGG - Intronic
1014707302 6:124763342-124763364 AGCATAGCAGCTTCTACTTCTGG + Intronic
1015500583 6:133929138-133929160 AGCAAATCAGTGTATCCTTAGGG - Intergenic
1015583834 6:134755583-134755605 AACACAGCAGCATCTGCTTCTGG - Intergenic
1016414624 6:143819931-143819953 AGCATAGCAGCATCTGCTTCTGG + Intronic
1018074507 6:160200024-160200046 AGCATAGCAGCATCTGCTTCTGG + Intronic
1018484232 6:164224728-164224750 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1019496751 7:1344335-1344357 AGCACCGCAGCTTCTGCTTCTGG + Intergenic
1019560242 7:1652257-1652279 AGGACATCAGCGTGTCCTTTGGG - Intergenic
1019735349 7:2647531-2647553 AGCCCAGCAGCGTCTCCAGCAGG - Exonic
1019918585 7:4149178-4149200 TGTACAGCAGCGTAGCCTCCTGG + Intronic
1020317269 7:6914679-6914701 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1023541413 7:41270720-41270742 ATCACACCAGGGTGTCCTTCAGG + Intergenic
1023706199 7:42944051-42944073 AGCATAGCAGCATCTGCTTCTGG - Intronic
1029195125 7:98800033-98800055 AACACAGCAGCTTCTGCTTCTGG - Intergenic
1030395625 7:108982381-108982403 AGCAGAGCAGCATCTGCTTCTGG - Intergenic
1031078118 7:117232276-117232298 AGCATAGCAGCATCTGCTTCTGG + Intergenic
1031164491 7:118212723-118212745 AGCATACCAGCGTCTGCTTCTGG - Intergenic
1032623595 7:133564187-133564209 AGCATAGCAGCTTCTGCTTCTGG + Intronic
1032894459 7:136235396-136235418 AGCACAGCAGCTTCTGCTTCTGG + Intergenic
1033313439 7:140279134-140279156 AGCATAGCAGCATCTGCTTCTGG - Intergenic
1034690960 7:153013312-153013334 AGCATAGCAGTGTCTGCTTCTGG - Intergenic
1035284331 7:157796674-157796696 AGCACGGCAGCTTCTGCTTCTGG + Intronic
1035733387 8:1869286-1869308 AGCTCAGCAGCCTTTCCCTCTGG + Intronic
1035760091 8:2062450-2062472 AGCCCAGCAGCAAATCCTGCTGG - Intronic
1036036936 8:5029888-5029910 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1037344078 8:17879669-17879691 AGCATAGCAGCATCTGCTTCTGG - Intronic
1039833775 8:41238796-41238818 AGCATAGCAGCTTTTGCTTCTGG + Intergenic
1041445880 8:57950370-57950392 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1041875182 8:62679573-62679595 AGCATAGCAGCTTCTGCTTCTGG + Intronic
1041964056 8:63654020-63654042 AGCATAGCAGCATCTGCTTCTGG + Intergenic
1043979871 8:86625054-86625076 AGCACAGCAGCATCTGCTTCTGG - Intronic
1044872630 8:96634435-96634457 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1045418986 8:101995452-101995474 AGCACAGTGGCATATGCTTCTGG + Intronic
1046011668 8:108556036-108556058 AGGAAAGGAGCGTATCCTTTGGG + Intergenic
1046046110 8:108966740-108966762 AGCATAGCAGCTTCTGCTTCTGG - Intergenic
1047415141 8:124658567-124658589 AGCACGGCAGCTTCTGCTTCTGG + Intronic
1047442680 8:124892579-124892601 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1047779261 8:128098238-128098260 AACACAGCAGCTTCTCCTCCTGG - Intergenic
1048738668 8:137530625-137530647 AGCACAGCAGCTTCTGATTCTGG - Intergenic
1048755296 8:137731757-137731779 AGCACAGCAGCAAAACCTTTAGG + Intergenic
1048856479 8:138690679-138690701 AGGACAGCAGTGTCTCCGTCTGG + Intronic
1050146345 9:2572297-2572319 AGTACAGCAGCATGTGCTTCTGG + Intergenic
1051969270 9:22867164-22867186 AGCATAGCAGCCTCTGCTTCTGG + Intergenic
1055331091 9:75184548-75184570 AGCATAGCTGCGTCTGCTTCTGG + Intergenic
1056038542 9:82635668-82635690 AGCATAGAAGCGTCTGCTTCTGG - Intergenic
1059011672 9:110468032-110468054 AGCATAGCAGCATCTGCTTCTGG - Intronic
1059347258 9:113637398-113637420 AGCATAGCAGCGTCTGCTTCTGG - Intergenic
1060699062 9:125734998-125735020 AGCATGGCAGCGTCTGCTTCTGG + Intergenic
1061974405 9:134061159-134061181 AGCACAGCAGCCTAGCCTTCAGG + Intronic
1203771789 EBV:53386-53408 AGCGCAGCAGCTTGTCCTTGAGG + Intergenic
1185710966 X:2303537-2303559 AGCAGAGCAGCTTCTGCTTCTGG - Intronic
1186062834 X:5729555-5729577 AGCACAGCAGCCTCTGCTTCTGG + Intergenic
1186668898 X:11749046-11749068 AGCACCACAGCCTATCCTTTGGG + Intergenic
1187122276 X:16421054-16421076 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1188339101 X:28977281-28977303 AGCATAGCAGCTTCTGCTTCTGG + Intronic
1188673266 X:32906352-32906374 AGCATAGCAGCTTCTGCTTCTGG - Intronic
1189353011 X:40291159-40291181 AGCATAGCAGCATCTGCTTCTGG + Intergenic
1189431221 X:40949509-40949531 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1189431534 X:40951545-40951567 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1190167810 X:48087734-48087756 AGCACAGCAGCTTCTGCTTTGGG + Intergenic
1191897397 X:66007519-66007541 AGCATAGCAGCATCTGCTTCTGG - Intergenic
1193412598 X:81182648-81182670 AGCATAGCAGCATCTACTTCTGG - Intronic
1194039126 X:88918075-88918097 AGCATAGCAGCATCTGCTTCTGG + Intergenic
1194178725 X:90687519-90687541 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1198999958 X:142624092-142624114 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1199119234 X:144030701-144030723 AGCATAGCAGCTTTTGCTTCTGG - Intergenic
1200108783 X:153728424-153728446 AGCTCAGGAGCGCATCCTCCTGG + Intronic
1200257727 X:154593525-154593547 AGCACAGCAGCATCTGTTTCTGG - Intergenic
1200352358 X:155511363-155511385 AGCATAGCAGCATCTTCTTCTGG - Intronic
1200525392 Y:4269690-4269712 AGCATAGCAGCTTCTGCTTCTGG + Intergenic
1201533922 Y:15024185-15024207 AGCAGAGCAGCATCTGCTTCTGG - Intergenic