ID: 1065124422

View in Genome Browser
Species Human (GRCh38)
Location 10:22560326-22560348
Sequence GTTTGGGGAGCCCGCCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065124418_1065124422 10 Left 1065124418 10:22560293-22560315 CCAGAAGGATACGCTGCTGTGCT 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1065124422 10:22560326-22560348 GTTTGGGGAGCCCGCCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065124422 Original CRISPR GTTTGGGGAGCCCGCCGCCC TGG Intronic
No off target data available for this crispr