ID: 1065126357

View in Genome Browser
Species Human (GRCh38)
Location 10:22577883-22577905
Sequence CGTTCAAGCCAGGATCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065126357_1065126361 -10 Left 1065126357 10:22577883-22577905 CCGCCTGGATCCTGGCTTGAACG No data
Right 1065126361 10:22577896-22577918 GGCTTGAACGTACACTTTGAGGG No data
1065126357_1065126362 -3 Left 1065126357 10:22577883-22577905 CCGCCTGGATCCTGGCTTGAACG No data
Right 1065126362 10:22577903-22577925 ACGTACACTTTGAGGGCAACTGG No data
1065126357_1065126364 -1 Left 1065126357 10:22577883-22577905 CCGCCTGGATCCTGGCTTGAACG No data
Right 1065126364 10:22577905-22577927 GTACACTTTGAGGGCAACTGGGG No data
1065126357_1065126363 -2 Left 1065126357 10:22577883-22577905 CCGCCTGGATCCTGGCTTGAACG No data
Right 1065126363 10:22577904-22577926 CGTACACTTTGAGGGCAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065126357 Original CRISPR CGTTCAAGCCAGGATCCAGG CGG (reversed) Intronic
No off target data available for this crispr