ID: 1065128759

View in Genome Browser
Species Human (GRCh38)
Location 10:22599774-22599796
Sequence CAGCTTTTGTGGTTTGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065128759_1065128764 23 Left 1065128759 10:22599774-22599796 CCTAGCTCAAACCACAAAAGCTG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1065128764 10:22599820-22599842 GTCCTCTCAACAGCAAATAAAGG No data
1065128759_1065128762 -10 Left 1065128759 10:22599774-22599796 CCTAGCTCAAACCACAAAAGCTG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1065128762 10:22599787-22599809 ACAAAAGCTGTTTGAGGCTCTGG No data
1065128759_1065128763 1 Left 1065128759 10:22599774-22599796 CCTAGCTCAAACCACAAAAGCTG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1065128763 10:22599798-22599820 TTGAGGCTCTGGTGCTATCTCGG No data
1065128759_1065128766 27 Left 1065128759 10:22599774-22599796 CCTAGCTCAAACCACAAAAGCTG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1065128766 10:22599824-22599846 TCTCAACAGCAAATAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065128759 Original CRISPR CAGCTTTTGTGGTTTGAGCT AGG (reversed) Intronic
900822498 1:4900099-4900121 TAGCTTTTGTGGTTGGAGGAGGG - Intergenic
900867561 1:5279288-5279310 CAGGGTTTGTGGCTTGACCTGGG - Intergenic
901273264 1:7970317-7970339 CAGATTTTGTGTTTTGAGAAGGG + Intronic
901746611 1:11377876-11377898 CAGCTTTGAGGGGTTGAGCTGGG - Intergenic
902593112 1:17489065-17489087 CAGCTGTGGTGGTCAGAGCTGGG + Intergenic
906896902 1:49784448-49784470 CATCATTTGTGGTTTGAGGAAGG - Intronic
908273200 1:62440856-62440878 AAGCATTTGTGTTTTGAGATGGG + Intronic
909846839 1:80404836-80404858 CAGCTTTTGTGGCCTGTTCTCGG - Intergenic
910959431 1:92746118-92746140 CAGCTCTTTTGGTTACAGCTTGG - Intronic
913229061 1:116725949-116725971 CCGCTTCTGTGGTGTGACCTTGG + Intergenic
916023893 1:160817718-160817740 CAGCTTTTATGGTGTGACCTTGG - Intronic
916422265 1:164648120-164648142 CAGCTTTTGTGTTATGCACTGGG + Intronic
917963923 1:180166689-180166711 CAGCTGCTCTGATTTGAGCTGGG + Intronic
918430528 1:184455379-184455401 CAGATTCTGTGGTCTGGGCTAGG + Intronic
922487376 1:225985047-225985069 CACATTTTTTGGTTTGATCTTGG - Exonic
1064619433 10:17200637-17200659 CAGATTTTGTGCTAGGAGCTGGG - Intronic
1065128759 10:22599774-22599796 CAGCTTTTGTGGTTTGAGCTAGG - Intronic
1068827562 10:61456184-61456206 CAGGTCTTGTGGTATGGGCTGGG + Intergenic
1071498428 10:86186953-86186975 TAGCTTTAGAGGTTTAAGCTGGG + Intronic
1072097955 10:92200837-92200859 CAGCTCTTCTGGTTTTAGCCAGG + Intronic
1072260786 10:93669705-93669727 CAGCTTGTGTGGTTTGTCTTTGG - Exonic
1073839669 10:107483835-107483857 CATCTTTTGTGATTTAACCTTGG + Intergenic
1074263116 10:111873864-111873886 CAGCTTTTTTGGCCTGAGTTTGG + Intergenic
1076759077 10:132591336-132591358 CACCTTGTCTGGTTTGGGCTGGG + Intronic
1078089477 11:8255656-8255678 CAGTTTTTCTGGTCTCAGCTGGG - Intronic
1078870073 11:15335253-15335275 CAGCCCTTGTGGTTGGGGCTTGG + Intergenic
1084176795 11:67426726-67426748 CAGCGTTTTTGGTTTTTGCTGGG + Intergenic
1089720671 11:120417295-120417317 CAGCTTTTGTGAGGTGAGGTGGG + Intronic
1091855602 12:3736965-3736987 CAGGCTTTGTGCTTTGTGCTGGG + Intronic
1093467567 12:19465750-19465772 CTGATTTTGTGCTTTGAGATTGG + Intronic
1093991603 12:25594529-25594551 CAGTTCTTGTAGTTTCAGCTTGG - Intronic
1094081238 12:26538165-26538187 CATCTTTTGTTGTGTGATCTTGG + Intronic
1094702477 12:32883265-32883287 CAGTATTTGTTGTTTGAGATTGG - Intronic
1095567245 12:43639602-43639624 CAGCTTTTGTGTTATAAACTTGG - Intergenic
1097987838 12:65803096-65803118 CAGCTTCTGTGCCTTGAGTTGGG - Intergenic
1098153849 12:67576618-67576640 CAGTTCTTCTGGTTTCAGCTGGG + Intergenic
1099152783 12:79135909-79135931 AAGCTTTTGTTGTTTAAACTTGG + Intronic
1099710772 12:86221718-86221740 CAGCTTGAGTGGTTACAGCTAGG - Intronic
1100228560 12:92584097-92584119 CAGTTCTTCTGGTCTGAGCTGGG - Intergenic
1100464334 12:94832034-94832056 CAGATTTTGTGGATAAAGCTGGG - Intergenic
1101076492 12:101134644-101134666 CAGCTTGGGTGGTAGGAGCTAGG - Intergenic
1103027904 12:117588434-117588456 GAGCTTTTGGGGTTTGGGCCTGG + Intronic
1103739526 12:123081869-123081891 CAGCTTTGGTGGGTTCAGGTGGG - Intronic
1106705597 13:32275742-32275764 CATCATTTGCAGTTTGAGCTGGG - Intronic
1109849301 13:68039326-68039348 CAGCTTTAGTGATTTGAGGGTGG + Intergenic
1110345418 13:74442009-74442031 AAGCTTTTGTTGTTTGACATGGG + Intergenic
1113111768 13:106831087-106831109 CTGTTTTTGTGATTTGAGTTAGG + Intergenic
1113390659 13:109893261-109893283 CAGGTTTTGGGGTTAGGGCTGGG + Intergenic
1119603779 14:75996891-75996913 CAGGTATTGTGCTTTGAACTTGG + Intronic
1120579752 14:86231232-86231254 CTGCCTTTCTGCTTTGAGCTGGG - Intergenic
1121842336 14:97144767-97144789 CTGGTATTGGGGTTTGAGCTTGG - Intergenic
1122319010 14:100842138-100842160 CAGCTTTTGTTTTGTGACCTTGG + Intergenic
1122587019 14:102815553-102815575 CAATTTTTGTGGTGTGAGATAGG + Intronic
1124247821 15:28085685-28085707 CAGCTTGTGAGGTTTGGGATGGG - Intronic
1124515084 15:30361066-30361088 CAGCTTTTGGGGCTGCAGCTGGG + Intergenic
1124727838 15:32169661-32169683 CAGCTTTTGGGGCTGCAGCTGGG - Intronic
1127018007 15:54710396-54710418 CAGCTTTTGTTGTTTTAGGATGG - Intergenic
1127051546 15:55089232-55089254 CAGCTTTTGGGGGGTGATCTAGG + Intergenic
1127235401 15:57045549-57045571 TAGTTTTTGTGTTTTGAGATAGG + Intronic
1127821224 15:62657953-62657975 CAGCTTTTTATTTTTGAGCTAGG + Intronic
1128176304 15:65559087-65559109 CAGCCTTTGAGATTTCAGCTGGG - Intronic
1129121907 15:73403314-73403336 CAGTTTTTGAGGTTAGAGATGGG - Intergenic
1129925521 15:79360231-79360253 CAACTGTTGAGGGTTGAGCTGGG + Intronic
1130953217 15:88608642-88608664 CAGCTTTGGTGTTTTGTGTTTGG + Intergenic
1133542475 16:6769705-6769727 AAGCTTCTGTGGCTTGATCTTGG + Intronic
1134379096 16:13707873-13707895 CAGGTTTTGTGTTTTGAGCAAGG - Intergenic
1134537575 16:15038807-15038829 CAGCTTTTGTTATTTGAGACAGG - Intronic
1134867415 16:17620616-17620638 CAGCTTTTGTTTTTTGATATAGG + Intergenic
1135109818 16:19681853-19681875 CTGCTTTTGTGGTTGGAACAGGG + Intronic
1135143737 16:19943610-19943632 CAGCTTTAGAAGTTTGAACTGGG - Intergenic
1135635199 16:24069829-24069851 CAGGTTTTGTGATTTGTTCTAGG - Intronic
1136026912 16:27474404-27474426 CAGCTTTTGCCGTTGGGGCTGGG + Intronic
1141365832 16:83441994-83442016 CAGCTCTTATGGTGTGACCTGGG - Intronic
1143564228 17:7711924-7711946 CTGCTTTTGTGGTTGGAGAATGG - Intergenic
1146212669 17:30954387-30954409 CAGCTCCTTTGGTTTGGGCTGGG + Intronic
1146599455 17:34201984-34202006 CAGCTTTTTTGGTTTTAGTCAGG - Intergenic
1146704855 17:34993759-34993781 TAGCTATTGTTGTTTGAGTTAGG + Intronic
1150809833 17:68347633-68347655 CAGCTTTGGTAGCTTGATCTTGG - Intronic
1151364824 17:73610342-73610364 CAGCTTTTGAGCTTGGAGCAGGG - Intronic
1154086172 18:11307559-11307581 CACATTTTGTGTTCTGAGCTGGG - Intergenic
1155290811 18:24339451-24339473 CAGCTGATGTGGTCTTAGCTTGG - Intronic
1156147290 18:34199563-34199585 TGGCTTTTATGGTTTGGGCTGGG - Intronic
1156570888 18:38251697-38251719 CAGCTATTATGGTTTAACCTAGG + Intergenic
1156734153 18:40232259-40232281 CAGCTTTTGTGTTTTTTGCTGGG + Intergenic
1158204210 18:54973574-54973596 AAGCTATTGTTATTTGAGCTAGG - Intergenic
1158298862 18:56030066-56030088 CGGGGTGTGTGGTTTGAGCTTGG - Intergenic
1158753714 18:60297571-60297593 CAGCTGGTGAGGTTTGAGTTGGG - Intergenic
1159217582 18:65415279-65415301 CAGCCTATGTTGTTTGTGCTGGG + Intergenic
1163517437 19:17773652-17773674 CAGCATTTGTGGCTGGAACTTGG - Intronic
1167301094 19:48678133-48678155 CAGCTTTTGTTTTTTGAGACAGG - Intergenic
925599854 2:5597174-5597196 GAGCTTATTTGGTTTGATCTGGG - Intergenic
929071624 2:38037357-38037379 CAGCTTTTGTGGTGTGGCCAGGG - Intronic
932414568 2:71565800-71565822 CAGGTTTTGAGGGTTGAGTTAGG + Intronic
933592270 2:84246209-84246231 CATCTCTTGCTGTTTGAGCTGGG - Intergenic
937275524 2:120681600-120681622 CAGCTATTGAGGGTTGGGCTGGG + Intergenic
937506403 2:122542190-122542212 CAGTCTTTGTGCTTTGAGATTGG - Intergenic
938554218 2:132409227-132409249 CAGCTTTTGTGGGTTGGGGAAGG - Intergenic
940669257 2:156647815-156647837 CAGGTTTATTGGTTTGGGCTTGG + Intergenic
944478848 2:200134610-200134632 CAGCTGTTGTTCTTTGAGCTAGG + Intergenic
946099110 2:217303547-217303569 CAGACTTTGTGGTTTGAGTAGGG + Intronic
947708890 2:232298553-232298575 CTGCTTTTGTGTTTTCATCTGGG + Intronic
948618625 2:239218084-239218106 CTGTTTTTGTTTTTTGAGCTGGG - Intronic
1169039979 20:2485279-2485301 CAGATTTTGTTGTTTTGGCTTGG - Intronic
1169166914 20:3431989-3432011 CATCTTTTTCTGTTTGAGCTGGG + Intergenic
1172481249 20:35273034-35273056 CAGCTTGTGTGGTGGGAGCTGGG + Intronic
1172996022 20:39071113-39071135 CAGGCTGTGTGGTTTGAGCTGGG - Intergenic
1180001801 21:44998477-44998499 CAGCTTCTGTGCTTCGTGCTAGG + Intergenic
1181051031 22:20238336-20238358 AAGTGTTTGTGGTGTGAGCTGGG - Intergenic
1181522289 22:23456636-23456658 CAGCTTTGCTTGTTTGAGCCAGG + Intergenic
1182158393 22:28097560-28097582 CATTTTTTGTGGTTTCAGATTGG - Intronic
1182256358 22:29041637-29041659 CAGTCTCTGTGGTTTGAGCCAGG + Intronic
1182891337 22:33821193-33821215 CAGCATTTGTGGGTGAAGCTGGG - Intronic
1183709441 22:39494051-39494073 CAGTTTTTCTGGTCTCAGCTGGG - Intergenic
1184226503 22:43131887-43131909 CGGCTTTTGTGTTTTCAGCCAGG + Intergenic
1184942574 22:47780012-47780034 AAGCTTTTGAGGGTTGAGATTGG + Intergenic
951211930 3:19984591-19984613 CAGGTTTTGTTGTTTGGGGTGGG + Exonic
952362337 3:32643323-32643345 CTGCTTTTGTGAGTGGAGCTTGG - Intergenic
953566428 3:44035792-44035814 CAGCTTTTGTGTCTTGGGGTTGG + Intergenic
954242444 3:49304513-49304535 CAGGCTTCGTGGTTTGAGTTGGG - Intronic
961996936 3:131255882-131255904 CAGCTTTATTGGTTACAGCTGGG - Intronic
962358815 3:134718037-134718059 CAGTCTTTGTGGTTTGGGCAGGG + Intronic
962919860 3:139940929-139940951 GAGCTTATGTGGTGTGATCTGGG + Intronic
965114574 3:164471484-164471506 CAGCTTATGTGATTTTAGCATGG + Intergenic
965400395 3:168206272-168206294 CAGCTTTTGTTCTATGAGATAGG + Intergenic
966772818 3:183519042-183519064 CTGCTTTTCTGCTTTCAGCTCGG - Intronic
969148484 4:5145039-5145061 CAGCTTTTGAAGTTTGAATTAGG - Intronic
974677737 4:65116430-65116452 CAGCCTTTGTCATTTGACCTTGG + Intergenic
978392007 4:108236777-108236799 CAGCTTCTGTGGGTCCAGCTTGG + Intergenic
979253358 4:118588004-118588026 CATCTTTTGTTTTTTGAGATAGG + Intergenic
982651626 4:158094546-158094568 CTGCTTTTCTGATTGGAGCTTGG - Intergenic
982943154 4:161584183-161584205 TAGCTTTAGTGGTTTGAGGAGGG - Intronic
983036386 4:162872194-162872216 CAACTTTTCCGGTTTGGGCTTGG + Intergenic
985243312 4:187954096-187954118 TAGTTTTTCTGGTTTGAGGTGGG + Intergenic
986457092 5:7930604-7930626 CAGCTTGTGTGTTTTAATCTTGG + Intergenic
986858871 5:11903954-11903976 CCGCTTTTGTTGTCTGAGCGCGG + Exonic
987797129 5:22641979-22642001 CAGTTTCTGTGCATTGAGCTTGG - Intronic
987876761 5:23690115-23690137 AAACTTTTGTGGTTGTAGCTGGG - Intergenic
988968188 5:36440751-36440773 CCCCTTTTTTGGTTTGAGTTTGG - Intergenic
992877052 5:81066859-81066881 CAGCTTTTGTGGTATAAACATGG + Intronic
995002034 5:107144901-107144923 CAGGTTTTGTGGTTTAAACCAGG - Intergenic
995948414 5:117679782-117679804 CATCTTTTGTGTTCTGAGATAGG + Intergenic
996124477 5:119708329-119708351 CAGCTGTTGTGGGTGGAGATGGG + Intergenic
996626398 5:125575103-125575125 CAGGTTCTATGCTTTGAGCTAGG + Intergenic
996871272 5:128195875-128195897 CATCTTTTGTTGTAAGAGCTAGG + Intergenic
998137311 5:139680917-139680939 CCACTTTTGTGCTTTGAGGTAGG - Exonic
999858635 5:155621540-155621562 CAGCTGGTGTGTTTTGAGCTGGG + Intergenic
1001052523 5:168424527-168424549 CAGCCTTTCTGGTTAGAGGTGGG + Intronic
1003406565 6:5831404-5831426 GTGCTTGTGTGGTTTGAGGTGGG - Intergenic
1003650337 6:7953644-7953666 CAGCTTCTGTAGATTTAGCTGGG - Intronic
1004262771 6:14122714-14122736 CATCTTTCATGGTTTGACCTAGG - Intronic
1004926839 6:20424077-20424099 CAGCTTTTACAGTTTGAGTTTGG + Intronic
1005812342 6:29527393-29527415 AAGCTTGTGGGGTTTGAGGTGGG - Intergenic
1008208757 6:48694645-48694667 CAGCTTTCCTAGTTTGAGCCAGG - Intergenic
1008446769 6:51600715-51600737 CAGCTTTTGTGGTTAGATGGGGG - Intergenic
1011323459 6:86122703-86122725 CAGGCTTTGTGCTTTGTGCTAGG + Intergenic
1012008403 6:93747016-93747038 CAGTTCTTGTAGTCTGAGCTGGG + Intergenic
1014008144 6:116444787-116444809 CATCTGTTGTGCTTTGATCTTGG + Intergenic
1014783150 6:125587800-125587822 CAGCCTGTCTGGTTTGAGCTAGG - Intergenic
1017658989 6:156655687-156655709 CAGCTGTTGCTGTTTGAGCACGG + Intergenic
1019589046 7:1819954-1819976 CAGCTTTCCTTGTTTGAGCCAGG - Intronic
1019809520 7:3154611-3154633 CAGCTTTTGTGGTCAGAAGTTGG + Intronic
1020888489 7:13849597-13849619 CAGATCTTGTGGTTAGAGATAGG + Intergenic
1021792193 7:24216963-24216985 AAGCTTTTGTGGTTTGGCCTGGG - Intergenic
1023057553 7:36302222-36302244 CCGCATTTGTGGGTGGAGCTGGG - Intergenic
1027193177 7:76009824-76009846 CAGCTGTGGTGGCTTAAGCTTGG - Intronic
1038331970 8:26616292-26616314 GAGCCTTTGTGGGTTGTGCTTGG - Intronic
1040978374 8:53219221-53219243 CAGCTTTTGTCTTTGCAGCTGGG - Intergenic
1041575750 8:59392911-59392933 CAGCTTTTGTGCTTGGACTTTGG + Intergenic
1044307662 8:90656770-90656792 CAGCCTTTGTGGTGTGTCCTTGG + Intronic
1044444838 8:92263930-92263952 CTGCTTTTGTCTTTTAAGCTTGG - Intergenic
1047155435 8:122312370-122312392 TAGCTTATGTGAATTGAGCTTGG + Intergenic
1047155437 8:122312399-122312421 TAGCTTATGTGAATTGAGCTTGG + Intergenic
1047319598 8:123767476-123767498 CAGCTGTTGAGGTGTGAGCTAGG + Intergenic
1047354075 8:124103737-124103759 CAGATTGTGTGGTATGTGCTTGG + Intronic
1047593331 8:126350478-126350500 AAGCTCTGCTGGTTTGAGCTGGG - Intergenic
1050488874 9:6166015-6166037 CAGCTTTAGTAGTCTGAGTTTGG - Intergenic
1051160795 9:14204996-14205018 TAGCTTTTGCCTTTTGAGCTTGG - Intronic
1052612714 9:30796966-30796988 CAGCTTTTGTAGGTAGTGCTTGG + Intergenic
1053329800 9:37193761-37193783 CAGCTTTTGTAGTAAGAGCAGGG - Intronic
1053520044 9:38768335-38768357 AAGCTTTTGTAGGTTGAGCAAGG - Intergenic
1054874170 9:70077882-70077904 CACCTTTTGTTGTTTGGGCTGGG - Intronic
1058296959 9:103321010-103321032 AAGATTTTGTGGTCTGAGGTAGG + Intergenic
1059477045 9:114555656-114555678 CCTCTTTTGTGTTATGAGCTAGG + Intergenic
1059982265 9:119785934-119785956 CATCTGTTGAGGTTTGACCTGGG - Intergenic
1059996069 9:119910971-119910993 CAGGTATTGTGGTTTGTGTTTGG + Intergenic
1062027748 9:134348273-134348295 CAGGGTCTGTGGTTGGAGCTTGG + Intronic
1185678822 X:1871477-1871499 CAGCTTCTGTGAATTGAGCCGGG - Intergenic
1185679042 X:1873257-1873279 CAGCTTCTGTGAATTGAGCTGGG - Intergenic
1186880728 X:13863473-13863495 TAGCTTTTGTGGTTTTCTCTGGG - Intronic
1188608365 X:32063076-32063098 CAGCTTTTGATGTTTCAGCCAGG + Intronic
1189423442 X:40877185-40877207 CACCTTTAATGGTTTGACCTAGG + Intergenic
1190393470 X:49955763-49955785 CAATTTATGTTGTTTGAGCTGGG + Intronic
1191201079 X:57782413-57782435 GAGCTTTTTTGGTTTGAGGCAGG - Intergenic
1193474794 X:81949777-81949799 CAGCTATTGTTCTTTTAGCTAGG - Intergenic
1194694684 X:97031438-97031460 CACCTTTTGTGCATTGAGGTAGG - Intronic
1195816545 X:108894748-108894770 CTGGGTTTGTGGCTTGAGCTAGG - Intergenic
1197085410 X:122468011-122468033 CAGCTTTTGTGGGTTGCCATGGG + Intergenic
1197482062 X:126999141-126999163 CTGGTTTTGTAGTTTGAGTTTGG - Intergenic
1198434107 X:136598565-136598587 CAGATTTTGTTGTTGGAACTAGG - Intergenic
1201485455 Y:14489385-14489407 AAGCTTTTGTTATTTCAGCTGGG - Intergenic
1201609390 Y:15823778-15823800 CAGGTTTTTTGGTTTGAGGGTGG + Intergenic