ID: 1065128865

View in Genome Browser
Species Human (GRCh38)
Location 10:22600656-22600678
Sequence CTCCTGGGCCGTGTGATTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065128865_1065128870 2 Left 1065128865 10:22600656-22600678 CCTCGAATCACACGGCCCAGGAG 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1065128870 10:22600681-22600703 AGGAGCAACTTGTCTGGAGAAGG No data
1065128865_1065128871 13 Left 1065128865 10:22600656-22600678 CCTCGAATCACACGGCCCAGGAG 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1065128871 10:22600692-22600714 GTCTGGAGAAGGCTGCTTTCTGG No data
1065128865_1065128872 14 Left 1065128865 10:22600656-22600678 CCTCGAATCACACGGCCCAGGAG 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1065128872 10:22600693-22600715 TCTGGAGAAGGCTGCTTTCTGGG No data
1065128865_1065128869 -4 Left 1065128865 10:22600656-22600678 CCTCGAATCACACGGCCCAGGAG 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1065128869 10:22600675-22600697 GGAGACAGGAGCAACTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065128865 Original CRISPR CTCCTGGGCCGTGTGATTCG AGG (reversed) Intronic
902541013 1:17154787-17154809 CTTCTGGGCTGTGTTATTTGGGG - Intergenic
904797202 1:33065520-33065542 GTCCTGGGCTGTGTGAGTCATGG - Intronic
915294629 1:154911317-154911339 GTCTTGGGCTGTGTGATTTGAGG + Intergenic
920712738 1:208310551-208310573 CTCCTAGGTCATGGGATTCGAGG - Intergenic
1065128865 10:22600656-22600678 CTCCTGGGCCGTGTGATTCGAGG - Intronic
1066488325 10:35870868-35870890 CTCCTGGGCCGGGGGTTTTGTGG + Intergenic
1067308544 10:45091082-45091104 CTCCTGGGCCGGGGGTTTTGTGG + Intergenic
1071442138 10:85708902-85708924 CTGCTGAGCCATGTGATTCATGG - Intronic
1074739225 10:116468449-116468471 CTCCTTGTCCGCGTGATTCAGGG + Intronic
1078509858 11:11977128-11977150 TTCCTGGGCAGTGTGACTTGGGG - Intronic
1078839891 11:15068720-15068742 GTCCTGGGCTGTGTGAGTCAAGG + Intronic
1081968717 11:47184768-47184790 CTCCAGAGCCCTGTGATTCATGG - Intronic
1086092863 11:83021381-83021403 CTTCTGGGCCCTGTGGTTCCTGG + Intronic
1089602924 11:119626325-119626347 CTCCTGGCATGTGTGATTCAGGG - Intronic
1090803233 11:130187615-130187637 CTCCTGGGCCAGGTGATGGGGGG + Intronic
1099555879 12:84107796-84107818 ATCCTGGGCTGTGTGAGTCCAGG + Intergenic
1113592981 13:111513748-111513770 CACCTGGGCCTTGTCATACGGGG + Intergenic
1115480715 14:33858476-33858498 CCCCTGGGCTGTGTGATTATGGG + Intergenic
1117278971 14:54219326-54219348 CTCCTGAGCCCTGAAATTCGTGG + Intergenic
1118615480 14:67572071-67572093 CTCCTGGGCTGCGTGAGTCGGGG + Intronic
1121709989 14:96030620-96030642 CTCTTGGGCAGTGTGGTGCGGGG - Intergenic
1128537249 15:68500611-68500633 CTCCTGCGCTGTGTGATTTGAGG - Intergenic
1132643630 16:988999-989021 CTCCTGGGCAGTGAGATTCGGGG + Intergenic
1132736063 16:1386817-1386839 CTCCTGGGCCGTGGGCTGAGGGG - Intronic
1132873163 16:2124474-2124496 CTCCTGGGCCGGGGGAGCCGGGG + Intronic
1133020850 16:2966394-2966416 CACCTGGACCGTGAGCTTCGTGG - Exonic
1134122396 16:11594396-11594418 TTTCTGGTCCGTGTGATTCCTGG - Intronic
1134552251 16:15143656-15143678 CTCCTGGGCCGGGGGAGCCGGGG + Intergenic
1138123058 16:54415849-54415871 CTCAGGGGCCATGTGATTAGAGG - Intergenic
1141977015 16:87523463-87523485 CTCCCTGGCCGTGTGACTCTAGG - Intergenic
1144316969 17:14070780-14070802 CTTCTGGTCTGTGTGATTCCAGG + Intronic
1144388221 17:14769951-14769973 CTTCTGGGAAGTGTGATTCCCGG + Intergenic
1147459383 17:40558615-40558637 CTCCTGGGCAGGGAGATTGGAGG + Intronic
1158555947 18:58474887-58474909 CTCCTGGGTCCTGGGATTTGGGG + Intergenic
1162914407 19:13866189-13866211 CTCCCCGGCAGTGGGATTCGGGG - Intronic
1164329897 19:24244262-24244284 GTCCTGGGCTGTGTGAGTCATGG - Intergenic
1164335939 19:24321404-24321426 GTCCTGGGCTGTGTGAATCGGGG - Intergenic
1164865990 19:31604954-31604976 CTCCTCAGCTGTGTGATTTGGGG - Intergenic
1165098919 19:33426857-33426879 GTCCTGGGCCTTGTGGTTCCTGG - Intronic
1167118353 19:47501224-47501246 GTTCTGGGCCCTGTGCTTCGAGG - Intronic
1167269239 19:48498575-48498597 CTCCTGGGTCGGGTGGCTCGGGG + Exonic
1167311994 19:48742111-48742133 CTCCTGGGTCATGAGAATCGTGG + Intronic
1167760459 19:51444069-51444091 CTCCTGGGACTTGGGATTTGTGG - Intergenic
1167998206 19:53423862-53423884 CTCCAGGGCGGTGTGGTTGGAGG - Intronic
925007022 2:451651-451673 CTCCTGGGCCCTCTGTTTCCAGG - Intergenic
925780469 2:7377216-7377238 CACCTTGGCCTTGAGATTCGTGG + Intergenic
927110696 2:19861934-19861956 CACCTGGGTAGTGTGATTCCAGG - Intergenic
935730307 2:106059710-106059732 GTCCTGGGCCCTGTGACTCAGGG + Intergenic
937095732 2:119234182-119234204 CTCCTGGGCAGGGTGAGCCGTGG - Intronic
939650613 2:144757659-144757681 CTCATGTGCTGTGTGATTCTGGG - Intergenic
948423135 2:237872647-237872669 CTCCTGGGCTGTGTGACTCTAGG + Intronic
1170709254 20:18775323-18775345 CTCCTGGGCCTGCTGATTCTAGG - Intergenic
1172194496 20:33083030-33083052 CTCCTGGGCGGTCTGCTTGGTGG + Intronic
1172705862 20:36881507-36881529 CCGCTGGGCCGTGTGAGTGGCGG + Intronic
1174137198 20:48388013-48388035 CTACTGGGCTGTGAGATTCAGGG - Intergenic
1175863160 20:62160936-62160958 CTTCTGTGCGGTGTGATCCGAGG + Intronic
1178521337 21:33290488-33290510 CTCCCTGGCCTTGTGATTTGAGG - Intronic
1178534133 21:33398589-33398611 CTCATTGGCTGTGTGATTTGGGG + Intergenic
1183958775 22:41398304-41398326 CTCCTGGGCCCTCTGCTTCTTGG + Exonic
1184374462 22:44102979-44103001 GTGCTGGGCCCTGGGATTCGGGG + Intronic
1184683623 22:46086025-46086047 CTCCTGGGCCTGGTGCTTCGAGG + Intronic
1184839241 22:47042992-47043014 CACGTGGGCTGAGTGATTCGGGG - Intronic
1185270942 22:49929149-49929171 CTCCTGGGCCCGGGGAGTCGAGG + Intergenic
957457608 3:80472627-80472649 CTCCTAGGCCCTGTGATGGGAGG - Intergenic
961509841 3:127394094-127394116 CTCCTGGGCTTTGAGATTTGGGG - Intergenic
961923503 3:130451617-130451639 ATCCTGGGCTGTGTGAGTCGGGG + Intronic
965404574 3:168253371-168253393 CTCCTGGGACATGTGATACTTGG + Intergenic
969339485 4:6531186-6531208 CTCCAGGGCAGTGTCCTTCGAGG + Intronic
976704713 4:88008114-88008136 CTCCTCGGCCGTGAGCTCCGTGG + Exonic
987537784 5:19209577-19209599 CTCCAGGGCTCTGTGATTCCTGG + Intergenic
995424760 5:112008177-112008199 CATCTGGGCCGTGTTATTCAAGG - Intergenic
997984148 5:138490239-138490261 CTCCACGGCCGTGTGATTTTTGG + Intergenic
1001011814 5:168105482-168105504 CTCCTGGGCCGTGAGAGACCGGG + Intronic
1004537825 6:16519904-16519926 CTCCTGGGGCCTGTGATATGCGG - Intronic
1008630547 6:53359573-53359595 CTCCCGGGCCGGGTAATTCCCGG + Intergenic
1009061329 6:58400755-58400777 GTCCTGGGCTGTGTGACTTGGGG - Intergenic
1009248999 6:61275307-61275329 GTCCTGGGCTGTGTGACTTGGGG - Intergenic
1019293392 7:261256-261278 CTCCTGGGCCGTGTGACGCTGGG - Intergenic
1019313750 7:375255-375277 CTTCTGGGCCGTGGGCCTCGCGG - Intergenic
1019452855 7:1108471-1108493 CGTTTGGGCCGTGAGATTCGTGG - Intronic
1019477822 7:1252441-1252463 CTCCTGCGCGGTGTGACTCCAGG + Intergenic
1021188652 7:17594797-17594819 CTCTTGGGCCCTGGAATTCGAGG + Intergenic
1023018558 7:35989022-35989044 CTCCTGCACTGTGTGATTCTGGG - Intergenic
1026780476 7:73263300-73263322 CTCCTGTGCAGTGTGGTTCTAGG - Intergenic
1027021335 7:74816741-74816763 CTCCTGTGCAGTGTGGTTCTAGG - Intronic
1027066690 7:75129196-75129218 CTCCTGTGCAGTGTGGTTCTAGG + Intronic
1032761453 7:134947336-134947358 CTCCTGGACTCTGTGATTCCGGG + Intronic
1035033875 7:155882643-155882665 CTCCTGGGCCCTGAGTTTCCTGG - Intergenic
1035298404 7:157880465-157880487 CTCCTGGGAGGTGTGAGTCTTGG + Intronic
1040139539 8:43894324-43894346 GTCCTGGGCTGTGTGAGTTGTGG - Intergenic
1042132475 8:65601237-65601259 CTCATGAGCTGTGTGATTCTAGG - Intergenic
1044814461 8:96097269-96097291 CTCTTGGTCCCTGTGATTGGTGG - Intergenic
1045524705 8:102931791-102931813 CTCTTGGGCAGTATGATTAGAGG - Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1050439780 9:5650021-5650043 CTCCTGGGCAGTGGGATGCTAGG + Intronic
1060818123 9:126646101-126646123 CTTCTTGGCAGTGTGATTAGGGG + Intronic
1061918652 9:133770189-133770211 CTCCTGGGCCATGTGACAGGCGG - Intronic
1062723091 9:138054585-138054607 CTCCTGTGCCGTGTGACTGATGG + Intronic
1188822998 X:34797795-34797817 GTCCTGGGCTGTGTGAGTCGGGG - Intergenic
1191851554 X:65589407-65589429 CTCCTGGGCCCAGCGATTCCAGG - Intronic
1193473385 X:81934108-81934130 CCTCTGGGCCTTGTGATTGGAGG - Intergenic
1197766273 X:130061035-130061057 CTCATGGACCCTGTGATCCGGGG + Intergenic
1200936201 Y:8740588-8740610 CTCCTTGGCCTAGGGATTCGTGG - Intergenic