ID: 1065130251

View in Genome Browser
Species Human (GRCh38)
Location 10:22613080-22613102
Sequence CAATGGGAGTGAAGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065130240_1065130251 13 Left 1065130240 10:22613044-22613066 CCATCGAGGCAGGAAGTGAAAAA 0: 1
1: 0
2: 1
3: 19
4: 303
Right 1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065130251 Original CRISPR CAATGGGAGTGAAGGGAAAA GGG Intronic
No off target data available for this crispr