ID: 1065137427

View in Genome Browser
Species Human (GRCh38)
Location 10:22685811-22685833
Sequence TGCCATTGCTGTGAGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065137427_1065137434 20 Left 1065137427 10:22685811-22685833 CCATGCCCCTCACAGCAATGGCA 0: 1
1: 0
2: 4
3: 19
4: 229
Right 1065137434 10:22685854-22685876 ACACCTCCAGTCATTCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065137427 Original CRISPR TGCCATTGCTGTGAGGGGCA TGG (reversed) Intronic
900290552 1:1921848-1921870 TGTCATGGCTGTGAGGGGAGGGG + Intergenic
900371098 1:2332555-2332577 GGGCAGTGCTGTGAGGGGCACGG + Intronic
900395379 1:2451221-2451243 TGCCTTGGCTGGGAGGGGGAGGG - Intronic
900534568 1:3170563-3170585 TGCCCTGGCTGCGAGGGGCGGGG + Intronic
900559199 1:3295336-3295358 TGCCAGTGCTGGGAGGGGACTGG + Intronic
900648661 1:3720478-3720500 TGCCATGGGTGTGAGGGGGCTGG - Intronic
900671781 1:3858835-3858857 TGGCAGGGCTGTGAGTGGCAAGG + Exonic
902036991 1:13465011-13465033 TGCCTTTCCTGTGAGAGGCCGGG - Intergenic
902432959 1:16377821-16377843 TGCCATTGCTCTGAGTGTGAAGG + Intronic
903418446 1:23200978-23201000 TGCCAGAGCTGGGAGAGGCATGG - Intergenic
904349075 1:29893344-29893366 GGCCATTGCTCTGAGGGGCAGGG + Intergenic
904438140 1:30512641-30512663 GGGCAGTGCAGTGAGGGGCAGGG - Intergenic
904694304 1:32319643-32319665 TGCCAGTGCTTTGAAGGGCAAGG + Intronic
905322663 1:37128945-37128967 TGCCATTCCTGGGAGGGGTCAGG + Intergenic
905972291 1:42151168-42151190 TCCCATTGATGTGGGGGTCAAGG + Intergenic
906611713 1:47208497-47208519 TCCCAGTGCTCTGAGGGGCGTGG - Intergenic
906685461 1:47760446-47760468 TGCCTTTGCTGTGAGGGCCAAGG - Intergenic
907004477 1:50896773-50896795 AGACAATGGTGTGAGGGGCATGG + Intronic
909358504 1:74735004-74735026 TGCCATTGCTCTGAAGGTGATGG - Intronic
914291865 1:146281425-146281447 TGACATTTTTGTGAGGGGAAAGG + Intergenic
914552909 1:148732208-148732230 TGACATTTTTGTGAGGGGAAAGG + Intergenic
916218782 1:162422264-162422286 TGGCATTGCTCTGAGGGGTAGGG - Intergenic
921710211 1:218366037-218366059 TCACATGGCTGTGAGGAGCATGG - Intronic
922969841 1:229727208-229727230 TCCCATTGCTGGGGGTGGCAGGG - Intergenic
923624295 1:235601618-235601640 TGACATTCCTGTGAGAGGAAGGG - Intronic
1063012745 10:2041312-2041334 TGGCTGTGCGGTGAGGGGCAGGG + Intergenic
1064585567 10:16836673-16836695 TGCCATTGCTCTGAGGATCTAGG + Intronic
1064695037 10:17956552-17956574 AGACATTGCTGTGAGGCACAGGG - Intronic
1065137427 10:22685811-22685833 TGCCATTGCTGTGAGGGGCATGG - Intronic
1067349825 10:45465572-45465594 TTCATTTGCTGTGAGGGGTAGGG - Intronic
1069817845 10:71209930-71209952 TGCCTTTGCTGTGAGGCCCATGG + Intergenic
1072495710 10:95957095-95957117 TGCCATGGGGCTGAGGGGCAGGG - Intronic
1073445136 10:103575909-103575931 TGACATTTCTGAGAGGAGCAAGG - Intronic
1074456920 10:113603389-113603411 TGCCTGTGCTGTGAGGGGCATGG + Intronic
1076003397 10:126929710-126929732 GACCATTGCGGGGAGGGGCAGGG + Intronic
1076041805 10:127256346-127256368 TGCAATGGCTGTGAAGGCCAAGG - Intronic
1077403952 11:2374451-2374473 TCCCATTGCACTTAGGGGCAGGG - Intergenic
1079348054 11:19670183-19670205 AGTCACTGCTGTGAGTGGCAAGG - Intronic
1081591057 11:44423518-44423540 TGCCATGCCTGTGGGGAGCAGGG - Intergenic
1082100443 11:48169056-48169078 TGCCAGTGAGGTGAGGGGCGTGG - Intronic
1083716930 11:64582892-64582914 TGCCAGTCCTGTGCTGGGCACGG + Intergenic
1084473797 11:69377619-69377641 CGCCAATGCTGTGGGGGGCAGGG + Intergenic
1084505271 11:69562975-69562997 TGCCTTTGCTGTCAGGGGTCAGG + Intergenic
1084913763 11:72412075-72412097 AGCCAGGGCTGGGAGGGGCAGGG + Intronic
1089272457 11:117311460-117311482 TGACATTGGTGTGAAGGGAAAGG - Intronic
1089659093 11:119974320-119974342 TGCCACAGCTCTGAGGGGCTTGG - Intergenic
1090886570 11:130882223-130882245 TGACATAGCTGTGTGGGTCATGG + Intronic
1093311402 12:17590843-17590865 TGACAATGCTGTGAGGGTGATGG + Intergenic
1096601685 12:52734310-52734332 TGCCAGTGCTGAGAAGGGCTGGG - Intergenic
1097151699 12:56984043-56984065 AGCCAATGCTGTGAAGTGCATGG + Intergenic
1101711203 12:107268415-107268437 TGCCCATGCTGTGAGAAGCAGGG - Intergenic
1102942519 12:116956212-116956234 TGCCTTTGCTGGAAGGAGCAGGG + Intronic
1103392102 12:120581769-120581791 TGCCTGGGCTGTGAGGTGCAGGG - Intergenic
1103573383 12:121859258-121859280 TTCCATAGCTCTGAGAGGCACGG + Intronic
1103810710 12:123611329-123611351 TCCCATTGCTGGGATGGGCCAGG + Intronic
1104267951 12:127254426-127254448 TCCTATTTCTGTGAGGTGCAAGG - Intergenic
1104971786 12:132534087-132534109 ACCCAGTGCTGAGAGGGGCAGGG + Intronic
1113766904 13:112887605-112887627 TGCCAGGGCTGGGAGTGGCAGGG - Intergenic
1113769781 13:112900658-112900680 AGCCTCTGCTGTGAGGGGCATGG + Intronic
1113886716 13:113664898-113664920 GGTCACTGCTGTGAAGGGCAGGG + Intergenic
1113948558 13:114058586-114058608 TGGCATTGCTCTGAGAGGGAAGG - Intronic
1115771252 14:36665737-36665759 TGCCATGGGTGTTAGTGGCAGGG - Intronic
1120871427 14:89340490-89340512 TGCCATGGATGTGAGAGGTACGG - Intronic
1122128417 14:99591518-99591540 TGCCCTTCCTCTGAGGTGCAGGG - Intronic
1122400528 14:101464808-101464830 TTCCATAGCCTTGAGGGGCAGGG - Intergenic
1124544703 15:30614518-30614540 TGCCATTGTTGTGCTGGGCTTGG + Exonic
1125722852 15:41853438-41853460 TGCCCATGCTCTGTGGGGCAGGG + Exonic
1127831921 15:62758552-62758574 TAACTCTGCTGTGAGGGGCAAGG - Intronic
1128073369 15:64811030-64811052 TGCCACTGCTGATGGGGGCAGGG - Intergenic
1128388610 15:67167661-67167683 TGCTCCTGCCGTGAGGGGCAGGG + Intronic
1129604360 15:77017598-77017620 CGCAATTGCTGTGATGGTCATGG + Intronic
1130977513 15:88788858-88788880 TGCCTCTGCTGTGGAGGGCAGGG - Intergenic
1131828079 15:96335579-96335601 TGTCATGGCTGAGAGGGGAAAGG + Intronic
1132052649 15:98620223-98620245 GGCCCTTGCTGGGAGGAGCACGG - Intergenic
1132126210 15:99227497-99227519 TCCCATAGCTGTGAAGGGTATGG - Intronic
1132665164 16:1078204-1078226 TGTCATTGCTGTGGGGGTGACGG + Intergenic
1135001348 16:18779467-18779489 TCCCATAGCCGTGAGGGTCAGGG + Intergenic
1136988873 16:35140003-35140025 TGCCTATGTTGGGAGGGGCATGG + Intergenic
1138204297 16:55113712-55113734 GGCCATCGCAGTGAGGGCCAAGG + Intergenic
1138581685 16:57945779-57945801 TGCCTTAGCCGTGAGTGGCATGG + Intronic
1138942537 16:61807617-61807639 TGCCAGAGATGTGAGGGGCGTGG + Intronic
1139372428 16:66477368-66477390 TGCCATTGTCGTGTTGGGCATGG - Intronic
1139377554 16:66509706-66509728 GGTCATGGCTGGGAGGGGCATGG - Exonic
1139653819 16:68375698-68375720 TACCATTGCTGGCAGGGCCATGG - Intronic
1140784373 16:78326153-78326175 TGCCATTGTGCTGAGGAGCAAGG + Intronic
1140852766 16:78950383-78950405 TGCCATTGTTCTGAGAGGAAGGG + Intronic
1142170873 16:88622139-88622161 TGGCATTGCTGTGAAGCGGAAGG + Intronic
1142514218 17:416430-416452 TTCCATGGCGGTGAGAGGCAGGG + Intronic
1143294772 17:5862726-5862748 TGCCATTTCTTTGGGGGGCCTGG + Intronic
1143500583 17:7336516-7336538 AGGCAGTGCTGGGAGGGGCAGGG - Exonic
1148243207 17:46013296-46013318 AGCCATGGCTGTGTGGGGCCTGG - Intronic
1150559963 17:66286048-66286070 TTCCCTTTCTGTGAGTGGCAGGG - Intergenic
1151048392 17:70948215-70948237 TGCAGCTGCTGTGAGGGCCAGGG - Intergenic
1151555774 17:74846035-74846057 TGCCATTGCTGGGATGCCCAGGG - Intronic
1152312198 17:79558242-79558264 CGCCTTTGCTCTGAGGGGCCTGG + Intergenic
1152922160 17:83071507-83071529 AGCCACTGCTGTGAGGGGACGGG + Intergenic
1152997105 18:417965-417987 TGGCTTAGCTGTGCGGGGCAGGG - Intronic
1153562602 18:6386309-6386331 TGCCATTGATGTCTGGGGAAGGG + Intronic
1156202466 18:34849879-34849901 TGCAAATGCTGAAAGGGGCAGGG - Intronic
1157479428 18:48044079-48044101 TGCCCTTGGTCTGAGGGGCCAGG + Intronic
1159138582 18:64365820-64365842 TGTCATTGTTGTGAGGGAGAAGG + Intergenic
1159936009 18:74368113-74368135 AGCCAAGGCTGTGAGAGGCAAGG + Intergenic
1160596094 18:79975482-79975504 TGGAGATGCTGTGAGGGGCAAGG - Intronic
1162796547 19:13090284-13090306 TGCGAATGCTGTGGGGAGCAGGG - Exonic
1163676573 19:18658337-18658359 TGCCAGAGCTGTGGGGGGCCTGG - Intronic
1164965131 19:32476650-32476672 TTCCAGGGGTGTGAGGGGCAGGG - Intronic
1165071989 19:33261090-33261112 TGCCCTAGCTTGGAGGGGCAAGG + Intergenic
1165115287 19:33524675-33524697 TGGCCATGCTGTGAGGGCCAGGG + Intergenic
1165303202 19:34985767-34985789 TGCCATTGATGTCTGGGGCCAGG - Intergenic
1166053331 19:40274138-40274160 GGCAAGTGCTGTGAGGGGAAGGG - Intronic
1166268293 19:41698316-41698338 TGCAATGGCTGTGAGGGTCACGG + Intronic
1166996630 19:46722632-46722654 TGCCCTGGCTGTGAGGGCCGGGG + Intronic
1167049444 19:47069406-47069428 TGGGTTTGCAGTGAGGGGCAGGG - Intronic
1167491925 19:49798004-49798026 TGCCATTGCTGTGTGTCCCATGG + Intronic
1168050243 19:53824376-53824398 AGCCATTGGTGAGTGGGGCAGGG - Exonic
925454958 2:4008133-4008155 TGCCATTGCTGGGTGGAGGAGGG + Intergenic
927138062 2:20111745-20111767 TGCCTGTGCAGTCAGGGGCAGGG + Intergenic
927799110 2:26080749-26080771 TGCCATTGCTTTGGGAGGCCAGG - Intronic
928435343 2:31251296-31251318 TGCCATGGCTGGGAGTGGAAAGG + Intronic
930719851 2:54628460-54628482 TGCCTTTGCTTTGAGTGGCTTGG + Intronic
931215163 2:60235212-60235234 TGCCAATGATGTGACAGGCAAGG - Intergenic
931607347 2:64065601-64065623 TGCCATGGCTCTCAGTGGCAAGG - Intergenic
932444721 2:71771258-71771280 TGCCATGGGTGTGAGTGGGAGGG + Intergenic
934860240 2:97758816-97758838 TGCCATTGCTGTGACATGGATGG - Intronic
935427437 2:102934756-102934778 AGCCATTGCTGCCTGGGGCATGG + Intergenic
936286227 2:111183410-111183432 TGCCATTCCTGTAAAGGGCACGG + Intergenic
938064209 2:128272288-128272310 TGGCATTCCAGTGAAGGGCATGG - Intronic
944529005 2:200649415-200649437 TGCCCCAGCTGTGAGGGGGAAGG - Intronic
1170297246 20:14841368-14841390 TTCCACTGAGGTGAGGGGCAAGG + Intronic
1171150616 20:22823739-22823761 TTGCATTGCTGTGAGGGGGCTGG + Intergenic
1171517163 20:25746972-25746994 TGCCAAGGCTATGAGGGTCAGGG - Intergenic
1172011278 20:31847291-31847313 TGCCTCTTCAGTGAGGGGCAGGG + Intergenic
1172505543 20:35459528-35459550 TGCCATTGCTTTGGGAGGCTTGG + Intronic
1173675356 20:44829991-44830013 TGCTATTGCTGTGAGCGCAAGGG - Intergenic
1178323884 21:31627709-31627731 CTCCATTGCTGTGTGGGACATGG - Intergenic
1179590946 21:42407446-42407468 GCCCACTGCTGTGAAGGGCATGG + Intronic
1179910976 21:44448756-44448778 TGCCATTGCTGAGCTGGCCAGGG - Intergenic
1181442064 22:22941832-22941854 TGCCCTTGCTGTGGGAGGCTGGG + Intergenic
1181859154 22:25804980-25805002 GCCCATGGCTGTGATGGGCAAGG + Intronic
1182771764 22:32801613-32801635 TGCCATTGGTCTGAGGGGGCGGG + Intronic
1183253395 22:36745648-36745670 TGCCAGTGCTGGGTGGAGCAGGG - Intergenic
1183598997 22:38829241-38829263 TGCAATTGCTGTCTAGGGCAGGG + Intronic
1185080390 22:48706391-48706413 TGCCAGTGCTGGGAGGGCCAGGG - Intronic
1185370982 22:50460789-50460811 TGTCATGGCTGCGAGGGGAAGGG - Intronic
952843667 3:37668913-37668935 TGCAATTGCAGTGAGAGGGAAGG + Intronic
952965308 3:38617423-38617445 TGCCATTTCTGTGAGATGCTTGG + Intronic
953213177 3:40894270-40894292 TGCCTTTGCTCTGAGGACCATGG + Intergenic
953520335 3:43636327-43636349 GGCCATTTCTGTGAGTAGCAAGG + Intronic
954412248 3:50375888-50375910 GGCCAGAGATGTGAGGGGCAGGG + Intronic
954873989 3:53788842-53788864 TGCATTTTCTGTGAGAGGCATGG + Intronic
955485228 3:59428211-59428233 TGAGATTGCTGTCAGGGCCAAGG - Intergenic
956896981 3:73672324-73672346 AGCCATTTCTGTCTGGGGCATGG + Intergenic
960134280 3:114089961-114089983 TGACAGTGCTGTGTAGGGCAGGG + Intergenic
961817538 3:129558941-129558963 TGGCAGGGCTGTGGGGGGCAGGG + Intronic
962879574 3:139563593-139563615 TGCCTTTGATTTGGGGGGCAGGG - Intronic
963064518 3:141252926-141252948 TGCCCCTGCTGAGAGGGGCAGGG + Intronic
964764213 3:160162761-160162783 TTCCATTGCTGTGGGTCGCAGGG - Intergenic
966426942 3:179789972-179789994 TGCCAATGCTGTGAGGAGACCGG - Intergenic
968789233 4:2647942-2647964 TGTCAGTGCTGTGAGGGACTGGG + Intronic
968946098 4:3665244-3665266 CAGCATTGCTGTTAGGGGCAGGG + Intergenic
969148488 4:5145065-5145087 TGCCCTTGCTGTCAAGGGCAGGG + Intronic
970194769 4:13543055-13543077 TGGGATTGCTGTGAGAGACATGG + Intronic
970301207 4:14683246-14683268 TGACATAGCTGTGATGGGCAGGG + Intergenic
973865176 4:55105732-55105754 TGCCATTCATGTGAGTGGCATGG - Intronic
975663360 4:76709188-76709210 GGCCATGGCTGAGAGGGGAAGGG - Intronic
975883629 4:78939471-78939493 AGCCCTAGCTGGGAGGGGCAGGG + Intergenic
978915896 4:114125713-114125735 TGCCAGTGGGGTGAAGGGCAGGG - Intergenic
981089777 4:140720704-140720726 TGCTATTTCTGTTAGGGGAAAGG + Intronic
982125024 4:152177050-152177072 TCCCAGTGCTTTGAGAGGCAAGG - Intergenic
982368996 4:154612909-154612931 ATCCATTGCTGTGAGGAGGAGGG + Intronic
982718673 4:158837097-158837119 TGCCAGTCCTGTCAGGGGCTGGG - Intronic
985270413 4:188189329-188189351 TGCCATGACTCTGAGGGACAAGG - Intergenic
990937085 5:61162554-61162576 CGCCATTGCTGTGTGGGTCTTGG + Intergenic
991657956 5:68921963-68921985 TGCCATTCCTGGTGGGGGCAAGG + Intergenic
993507376 5:88726568-88726590 TTCCATTGATTTGAGGGGTAAGG + Intronic
993704946 5:91159106-91159128 TGCCATTGCTCTAAGGGGCAAGG + Intronic
994220819 5:97193011-97193033 TGCAGCTGCTGTGGGGGGCAGGG + Intergenic
995486762 5:112647548-112647570 TTCCATGGCTGTGAGGAGAAAGG - Intergenic
998132906 5:139660154-139660176 TGCCAGTGCAGTGAGGGGAGCGG + Intronic
998204515 5:140149295-140149317 TGCCATTCTTCTGAGGGACAGGG - Intergenic
998269771 5:140696041-140696063 TGCCATTGTTTTGAGTGGAAGGG + Intronic
999304128 5:150508882-150508904 TGCAACTGCAGTGAGGGGTATGG - Intronic
999736623 5:154517824-154517846 TGCCATAGATGCCAGGGGCAGGG + Intergenic
999744322 5:154580281-154580303 TGTCATCACTGTGAGGGGCGCGG - Intergenic
1000477577 5:161730543-161730565 TGCCATAACTGTGGGGGCCAAGG - Intergenic
1000825740 5:166041717-166041739 TGCCATTGCTGTTAGATGGATGG - Intergenic
1001457541 5:171876401-171876423 CTCCATTGCTGTGTGGGACATGG - Exonic
1002133509 5:177095104-177095126 TGCAACTGCTGTGACAGGCAGGG + Intronic
1002160223 5:177310578-177310600 TGCCATTCCTGTGGCCGGCAAGG - Intronic
1002456124 5:179346031-179346053 TGCCCTTACTGAGAGAGGCAAGG + Intergenic
1002653307 5:180720769-180720791 TCCCTTAGCTGTGAGGGGCTGGG - Intergenic
1002908541 6:1470558-1470580 TGTGATTGCTGTGGGGGGAAAGG + Intergenic
1003370586 6:5522200-5522222 TTCCCTTGCTGTGAGGGCCTTGG - Intronic
1007171681 6:39868621-39868643 TGCCACTGAGGTGAGAGGCAAGG + Intronic
1007721309 6:43887049-43887071 CTCCATTGCTGGGAGGGCCAGGG - Intergenic
1016185890 6:141197035-141197057 TGCCACTGCTGCCAGGGGTAGGG + Intergenic
1016241168 6:141932882-141932904 TGCAATCACTGTGAGTGGCAAGG - Intergenic
1018324937 6:162656643-162656665 TCTCATTGCAGTGAGGAGCAAGG - Intronic
1019341149 7:509666-509688 TGCCATCAGTGTGAGGGGCGGGG - Intronic
1020679021 7:11214221-11214243 TACCATTGGAGTGAGGGGTAGGG - Intergenic
1022596659 7:31719353-31719375 TGCCTGTCCTGTGAGGGGAAAGG + Intergenic
1023514803 7:40991321-40991343 TGCAATTGTTTTGAGGTGCAAGG - Intergenic
1023905889 7:44521376-44521398 TGCCACTGCTTTGGGCGGCAGGG + Intronic
1024310618 7:47965872-47965894 TGCCAATCCCGTGAGGGCCATGG + Intronic
1025727571 7:64081387-64081409 AGCAATTGCTGGGAGTGGCAGGG + Intronic
1027408349 7:77886723-77886745 CTCCATTGTGGTGAGGGGCAGGG + Intronic
1027847958 7:83408597-83408619 TACTATTGCTGTTAGGAGCATGG + Intronic
1029172463 7:98640674-98640696 TGCCCTTGCTGTGTGGCCCAGGG + Intergenic
1029421211 7:100472711-100472733 TGCCAGTGCTGGGTGGGGCTGGG - Intronic
1031964088 7:128014897-128014919 TGCCTTAGCAGTGAGAGGCAAGG + Intronic
1032087973 7:128893611-128893633 TGGCATAGCTGTGGGGGGCAGGG - Intronic
1032109854 7:129066730-129066752 TGTCATTGTTTTGGGGGGCAGGG - Intergenic
1033149933 7:138905381-138905403 AGCCAGGGCTCTGAGGGGCACGG - Intronic
1033216200 7:139495402-139495424 TGTCACTGCTGTCAGGAGCAGGG + Intergenic
1034959473 7:155355986-155356008 TTCCGTGGCCGTGAGGGGCAAGG + Intergenic
1035242105 7:157538786-157538808 TGCCAGTGCACGGAGGGGCACGG + Intergenic
1036581806 8:10081949-10081971 TCCCAGCGCTGTGAGGGCCAAGG + Intronic
1037105143 8:15097456-15097478 TCCCATTGCTAGGATGGGCATGG + Intronic
1037542060 8:19881495-19881517 TGCCGTTGCTGTGGGGGGACCGG - Intergenic
1037591150 8:20313173-20313195 GCCCAGTGCTGGGAGGGGCAGGG + Intergenic
1037861938 8:22411696-22411718 TGCCAGTGGTGTGACTGGCAGGG - Intronic
1039466679 8:37789515-37789537 TGTCAGTGCTGTGAAGGGAAAGG - Intronic
1039545292 8:38405750-38405772 TTAGATTGCTGTCAGGGGCAAGG + Intronic
1039852430 8:41380820-41380842 TGCTATAGCTGTGAGGGTTAGGG - Intergenic
1040994619 8:53389285-53389307 TGCCATTCATGTGCAGGGCAGGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1044834603 8:96283349-96283371 TTCCATAGCTGTGAGGTGTAAGG + Intronic
1044927071 8:97218496-97218518 TGGTTGTGCTGTGAGGGGCATGG - Intergenic
1046493750 8:114986693-114986715 TGCCATTGGTGTGGGGGGAAGGG - Intergenic
1048700279 8:137080560-137080582 TGACATTCCTGTGATGAGCAGGG + Intergenic
1048976226 8:139674492-139674514 TGCAACCTCTGTGAGGGGCAGGG + Intronic
1049302488 8:141879067-141879089 TCCCACTGCTGGGAGGAGCAGGG + Intergenic
1049864319 8:144924011-144924033 TGGCATTGAGGTGAGGGGAAGGG + Intergenic
1050425810 9:5511540-5511562 TACTATGGCTCTGAGGGGCAGGG + Intronic
1051504448 9:17812166-17812188 AGCCAGGGGTGTGAGGGGCATGG + Intergenic
1052821327 9:33139818-33139840 CGCCCTTGCTGTGCGGCGCATGG + Intronic
1054936615 9:70695113-70695135 TCCAGTTGTTGTGAGGGGCATGG - Intronic
1057349139 9:94279792-94279814 TGCTATTTCTGTGTGGTGCATGG + Intronic
1059253102 9:112904869-112904891 TACCATTTCTGTGAGGGGTAAGG + Intergenic
1061033287 9:128099726-128099748 TGCCAAAGGTGTCAGGGGCAGGG - Intronic
1061486770 9:130924222-130924244 TGCCACTGGTGAGTGGGGCAGGG - Exonic
1061499820 9:130995407-130995429 TGTCCTTGCTCAGAGGGGCAGGG + Intergenic
1061507961 9:131042648-131042670 TGCCATGGCTGTGAAAGGCAAGG - Intronic
1062028237 9:134350362-134350384 TTCCTTTTCTGTAAGGGGCATGG + Intronic
1185513089 X:677626-677648 TCCCACTGCTGTGAGGGCCATGG + Intergenic
1186174000 X:6906121-6906143 TGCCATGGCTCTGGGGGGCAAGG + Intergenic
1187844792 X:23524338-23524360 TGCCATTGCTGTTGTGGGGATGG - Intergenic
1193939891 X:87669403-87669425 TGTCATTGCTGTGTGGAGAAAGG - Exonic
1196459196 X:115912225-115912247 TGCACCTGCTGTGATGGGCAGGG - Intergenic
1197170588 X:123429499-123429521 TGCCATAGTAGTGAGGGTCAAGG - Intronic
1198038889 X:132829587-132829609 TGACATGGCTGGCAGGGGCAAGG - Intronic
1198517517 X:137424870-137424892 GGCCATTCCTGGGAGGGGGAGGG - Intergenic
1199238023 X:145512410-145512432 TGTTATTGCTTTCAGGGGCAGGG - Intergenic