ID: 1065140496

View in Genome Browser
Species Human (GRCh38)
Location 10:22714542-22714564
Sequence CGCGGATCCGCGGCGGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 194}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065140496_1065140510 25 Left 1065140496 10:22714542-22714564 CCTGCGCCCGCCGCGGATCCGCG 0: 1
1: 0
2: 0
3: 16
4: 194
Right 1065140510 10:22714590-22714612 GCGGCGAGCGGCTTCCGCGTTGG 0: 1
1: 0
2: 1
3: 2
4: 55
1065140496_1065140511 26 Left 1065140496 10:22714542-22714564 CCTGCGCCCGCCGCGGATCCGCG 0: 1
1: 0
2: 0
3: 16
4: 194
Right 1065140511 10:22714591-22714613 CGGCGAGCGGCTTCCGCGTTGGG 0: 1
1: 0
2: 0
3: 2
4: 23
1065140496_1065140506 6 Left 1065140496 10:22714542-22714564 CCTGCGCCCGCCGCGGATCCGCG 0: 1
1: 0
2: 0
3: 16
4: 194
Right 1065140506 10:22714571-22714593 CCGCGGCTGGACCCGGCGCGCGG 0: 1
1: 0
2: 2
3: 12
4: 170
1065140496_1065140501 -7 Left 1065140496 10:22714542-22714564 CCTGCGCCCGCCGCGGATCCGCG 0: 1
1: 0
2: 0
3: 16
4: 194
Right 1065140501 10:22714558-22714580 ATCCGCGCTCAGCCCGCGGCTGG 0: 1
1: 1
2: 2
3: 11
4: 81
1065140496_1065140507 13 Left 1065140496 10:22714542-22714564 CCTGCGCCCGCCGCGGATCCGCG 0: 1
1: 0
2: 0
3: 16
4: 194
Right 1065140507 10:22714578-22714600 TGGACCCGGCGCGCGGCGAGCGG 0: 1
1: 0
2: 0
3: 10
4: 93
1065140496_1065140503 -1 Left 1065140496 10:22714542-22714564 CCTGCGCCCGCCGCGGATCCGCG 0: 1
1: 0
2: 0
3: 16
4: 194
Right 1065140503 10:22714564-22714586 GCTCAGCCCGCGGCTGGACCCGG 0: 1
1: 0
2: 6
3: 39
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065140496 Original CRISPR CGCGGATCCGCGGCGGGCGC AGG (reversed) Exonic