ID: 1065141835

View in Genome Browser
Species Human (GRCh38)
Location 10:22725773-22725795
Sequence ATGGTGTGATGGAGGTTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065141835_1065141839 -6 Left 1065141835 10:22725773-22725795 CCAGGTAACCTCCATCACACCAT No data
Right 1065141839 10:22725790-22725812 CACCATGGTCTCTTCCACCGAGG No data
1065141835_1065141842 8 Left 1065141835 10:22725773-22725795 CCAGGTAACCTCCATCACACCAT No data
Right 1065141842 10:22725804-22725826 CCACCGAGGCCCCTGTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065141835 Original CRISPR ATGGTGTGATGGAGGTTACC TGG (reversed) Intergenic
No off target data available for this crispr