ID: 1065145894

View in Genome Browser
Species Human (GRCh38)
Location 10:22767811-22767833
Sequence TTGGGTCACCAAAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065145894_1065145899 -6 Left 1065145894 10:22767811-22767833 CCATCTTCCTTTTGGTGACCCAA No data
Right 1065145899 10:22767828-22767850 ACCCAAGTTGATGGGGAATTTGG No data
1065145894_1065145902 -2 Left 1065145894 10:22767811-22767833 CCATCTTCCTTTTGGTGACCCAA No data
Right 1065145902 10:22767832-22767854 AAGTTGATGGGGAATTTGGAAGG No data
1065145894_1065145904 7 Left 1065145894 10:22767811-22767833 CCATCTTCCTTTTGGTGACCCAA No data
Right 1065145904 10:22767841-22767863 GGGAATTTGGAAGGTAGTGGTGG No data
1065145894_1065145903 4 Left 1065145894 10:22767811-22767833 CCATCTTCCTTTTGGTGACCCAA No data
Right 1065145903 10:22767838-22767860 ATGGGGAATTTGGAAGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065145894 Original CRISPR TTGGGTCACCAAAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr