ID: 1065150480

View in Genome Browser
Species Human (GRCh38)
Location 10:22817611-22817633
Sequence CCCCCCAGTGTGACTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065150480_1065150485 6 Left 1065150480 10:22817611-22817633 CCAGACACAGTCACACTGGGGGG No data
Right 1065150485 10:22817640-22817662 AAACCTGCAAACTCATATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065150480 Original CRISPR CCCCCCAGTGTGACTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr