ID: 1065154123

View in Genome Browser
Species Human (GRCh38)
Location 10:22852318-22852340
Sequence CTGCTGAGTTTGAGGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065154119_1065154123 25 Left 1065154119 10:22852270-22852292 CCTTCTGTTACAGCTTCAATGTT No data
Right 1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065154123 Original CRISPR CTGCTGAGTTTGAGGAAGAA GGG Intergenic
No off target data available for this crispr