ID: 1065162476

View in Genome Browser
Species Human (GRCh38)
Location 10:22937439-22937461
Sequence AACAGATTTCCCTTCCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 294}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065162476_1065162481 4 Left 1065162476 10:22937439-22937461 CCAAGAGGGAAGGGAAATCTGTT 0: 1
1: 0
2: 3
3: 17
4: 294
Right 1065162481 10:22937466-22937488 ATGTGGGTTGGTGGAGAAGATGG No data
1065162476_1065162484 21 Left 1065162476 10:22937439-22937461 CCAAGAGGGAAGGGAAATCTGTT 0: 1
1: 0
2: 3
3: 17
4: 294
Right 1065162484 10:22937483-22937505 AGATGGCCAGCTGGGACATGAGG No data
1065162476_1065162480 -5 Left 1065162476 10:22937439-22937461 CCAAGAGGGAAGGGAAATCTGTT 0: 1
1: 0
2: 3
3: 17
4: 294
Right 1065162480 10:22937457-22937479 CTGTTTTAGATGTGGGTTGGTGG No data
1065162476_1065162485 22 Left 1065162476 10:22937439-22937461 CCAAGAGGGAAGGGAAATCTGTT 0: 1
1: 0
2: 3
3: 17
4: 294
Right 1065162485 10:22937484-22937506 GATGGCCAGCTGGGACATGAGGG No data
1065162476_1065162482 12 Left 1065162476 10:22937439-22937461 CCAAGAGGGAAGGGAAATCTGTT 0: 1
1: 0
2: 3
3: 17
4: 294
Right 1065162482 10:22937474-22937496 TGGTGGAGAAGATGGCCAGCTGG No data
1065162476_1065162479 -8 Left 1065162476 10:22937439-22937461 CCAAGAGGGAAGGGAAATCTGTT 0: 1
1: 0
2: 3
3: 17
4: 294
Right 1065162479 10:22937454-22937476 AATCTGTTTTAGATGTGGGTTGG No data
1065162476_1065162483 13 Left 1065162476 10:22937439-22937461 CCAAGAGGGAAGGGAAATCTGTT 0: 1
1: 0
2: 3
3: 17
4: 294
Right 1065162483 10:22937475-22937497 GGTGGAGAAGATGGCCAGCTGGG No data
1065162476_1065162486 23 Left 1065162476 10:22937439-22937461 CCAAGAGGGAAGGGAAATCTGTT 0: 1
1: 0
2: 3
3: 17
4: 294
Right 1065162486 10:22937485-22937507 ATGGCCAGCTGGGACATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065162476 Original CRISPR AACAGATTTCCCTTCCCTCT TGG (reversed) Intronic
901108214 1:6774159-6774181 AACACAGTTTCCTTCCCTCCTGG - Intergenic
901133916 1:6980491-6980513 AACAGAAGTCACGTCCCTCTAGG - Intronic
901566203 1:10117764-10117786 AACAGAGATCCCTGCCCTCGTGG + Intronic
901876075 1:12167620-12167642 AAAAGACTTCCTTTTCCTCTGGG + Intronic
902130969 1:14260218-14260240 GACAGATATCCCTGCCCTCGTGG + Intergenic
902342021 1:15790001-15790023 AGATGATTTCCCTTCCCTTTGGG + Intergenic
904699729 1:32351338-32351360 TCCCGATTTCCCTTCCCTCCAGG - Intergenic
904912428 1:33945380-33945402 AAGAGATACCTCTTCCCTCTGGG - Intronic
906702126 1:47867179-47867201 AACATTTTTGCCTTCCCTCTTGG - Intronic
906852593 1:49267828-49267850 AAGAGATTTCCCCTTTCTCTTGG - Intronic
908002820 1:59697520-59697542 ATCAGAATTTCCTTCCTTCTTGG + Intronic
908621468 1:65985659-65985681 AACAGCTTCCCCTTCCATTTAGG + Intronic
908803718 1:67907932-67907954 ACTAGATTTCCCCTCCCACTCGG - Intergenic
909915716 1:81316367-81316389 AACAAAATTACCTTTCCTCTGGG + Intronic
910564577 1:88628979-88629001 AACAGATTTCCCCTCCAGTTAGG - Intergenic
911688134 1:100800693-100800715 TAGACATTTCCCTTCCTTCTGGG - Intergenic
911703964 1:100988972-100988994 AACAGATTTCCCTATTCCCTGGG - Intergenic
912155396 1:106912574-106912596 AACATAGTTCCTTTCCCTCAAGG - Intergenic
913253771 1:116935733-116935755 CACAGGTTTCTCTTACCTCTCGG - Intronic
915286398 1:154856096-154856118 AACAGATTTGTCTTCTCACTGGG - Intronic
918300876 1:183202818-183202840 AACAGATGTCCCAGCCCTCACGG - Intronic
919020687 1:192101316-192101338 AACACATTTCCTTTTCCTTTAGG - Intergenic
920688931 1:208131088-208131110 AACACCTTTCCCCTCCCTCAGGG + Intronic
923309150 1:232718504-232718526 AACACATTTTCCCTTCCTCTTGG + Intergenic
1065101412 10:22335841-22335863 AGCAGCTTTCCTCTCCCTCTCGG + Intergenic
1065162476 10:22937439-22937461 AACAGATTTCCCTTCCCTCTTGG - Intronic
1067826686 10:49579223-49579245 AACATATTTACCCTCCCACTTGG + Intergenic
1069694881 10:70379386-70379408 AGCTGATTTGCCTCCCCTCTTGG - Intronic
1070575276 10:77672806-77672828 AACTGTTTACCCATCCCTCTTGG + Intergenic
1070803685 10:79257902-79257924 AAGCGAGGTCCCTTCCCTCTGGG - Intronic
1073759916 10:106618289-106618311 AAGAGCTTTCCCTTCACTCTGGG - Intronic
1075536781 10:123278190-123278212 AACGGGTTTCCCTTTTCTCTTGG - Intergenic
1077550918 11:3199925-3199947 AACAGATTTCTCTGCCCTGGGGG + Intergenic
1077739038 11:4824584-4824606 AAGACATTTCTCTTCCCTCATGG + Intronic
1079172812 11:18112553-18112575 AACAAATGTCCCTGCCCTCAGGG + Intergenic
1079489239 11:20968955-20968977 AACAGATTTTTCTTTCCTCCTGG - Intronic
1079959707 11:26907975-26907997 AAAAGAGTTCTCCTCCCTCTTGG + Intergenic
1079989792 11:27234384-27234406 ATCAGATTTCACAGCCCTCTTGG + Intergenic
1080108798 11:28542104-28542126 AAATGAGTTCCCTGCCCTCTTGG - Intergenic
1080992683 11:37558426-37558448 CACAGTTTTCCCTTCCAACTGGG - Intergenic
1085757070 11:79210642-79210664 AGCAGATTTTCCTCCCCTCCGGG - Intronic
1090149513 11:124367628-124367650 TCAAGTTTTCCCTTCCCTCTAGG + Intergenic
1090677011 11:129007903-129007925 GACAGATTTCCCCTCTGTCTAGG + Intronic
1090909249 11:131104214-131104236 AACTGATTTCTCTCCTCTCTGGG - Intergenic
1091978258 12:4844209-4844231 AACAGAATTCCCTGTCCTCGTGG + Intronic
1092350144 12:7749591-7749613 AATAGATTTCACTTCCCTGAAGG - Intronic
1093208480 12:16279770-16279792 AACAGCTTGCCCTTGCATCTAGG - Intergenic
1093384769 12:18538929-18538951 ATCAGATTTTTCTTCCCTCATGG - Intronic
1094423273 12:30294688-30294710 ACAAGATTTCCCTTGCTTCTTGG - Intergenic
1094479720 12:30871971-30871993 CACTGATGTCCCTTCCCTATTGG + Intergenic
1094787016 12:33860296-33860318 AAGAGGTTTCCCTTTTCTCTTGG - Intergenic
1095824398 12:46516455-46516477 AACAGCCTGCCCCTCCCTCTGGG + Intergenic
1096683417 12:53272167-53272189 AACAAAGTTTCCTTCCCTCATGG + Intronic
1097182193 12:57177886-57177908 AAGAAGTTTCCCCTCCCTCTGGG - Intronic
1097627449 12:62018193-62018215 AAAATATTTCCCATCCCTCCAGG + Intronic
1097679282 12:62633597-62633619 AACTGTTTTCCCTTCCCTGGTGG + Intergenic
1099250992 12:80253714-80253736 TACAGATGTCCCTTCCCCCAAGG - Intronic
1099357124 12:81651314-81651336 AACAGTTTTTCCATCTCTCTTGG - Intronic
1102321427 12:111938789-111938811 AATAGTTTTTCCTACCCTCTAGG + Intronic
1102359451 12:112271571-112271593 AATAGAATTTCCTTCCCTGTGGG - Intronic
1102376163 12:112422931-112422953 AGCTTATTCCCCTTCCCTCTGGG + Intronic
1102484800 12:113248369-113248391 AACAAAAGTCCCTGCCCTCTTGG + Intronic
1105582748 13:21715917-21715939 AAAAGTTTTCCCATGCCTCTTGG - Intergenic
1105669698 13:22599216-22599238 AATTGATTTCCCAACCCTCTAGG + Intergenic
1107249810 13:38346100-38346122 AACAAAGTTCCCTTCATTCTAGG + Intergenic
1109830734 13:67783811-67783833 AAAAGATCTCACTTCCATCTTGG - Intergenic
1111653044 13:91116665-91116687 AAAAGATTTCCTCTTCCTCTTGG - Intergenic
1112027362 13:95423673-95423695 AAGAGATTTCCCTTTTCACTTGG - Intergenic
1112496354 13:99908233-99908255 CTCAGAACTCCCTTCCCTCTGGG + Intergenic
1112910909 13:104482904-104482926 AAATGATTTCACTTCCTTCTTGG - Intergenic
1114489327 14:23088198-23088220 AAGAGCTTTCTCTTTCCTCTCGG + Intronic
1115464985 14:33705474-33705496 AGCCGATTTCGCCTCCCTCTTGG - Intronic
1118494417 14:66294151-66294173 AACACTTTCCCCTTCCCTTTGGG - Intergenic
1124925628 15:34067692-34067714 AAACGCTTTCCCTTCCCTATGGG + Intergenic
1125198589 15:37077469-37077491 GTCAGATTTCACTTCCCTCATGG + Intronic
1126225314 15:46262655-46262677 AACAGCCTTCCCCTCCCTCTGGG + Intergenic
1126676184 15:51160933-51160955 AACAAATTTCCCAAACCTCTAGG + Intergenic
1126693095 15:51303008-51303030 TAGTAATTTCCCTTCCCTCTTGG + Intronic
1129595983 15:76964735-76964757 AACATAATTGCCTTCCCTCTTGG + Intergenic
1130274934 15:82471478-82471500 AATACATTTACCTGCCCTCTGGG - Intergenic
1130378614 15:83353047-83353069 ACCAGACTACCCTTCCCTTTAGG - Intergenic
1130467281 15:84198847-84198869 AATACATTTACCTGCCCTCTGGG - Intergenic
1130496981 15:84474689-84474711 AATACATTTACCTGCCCTCTGGG + Intergenic
1130589578 15:85203445-85203467 AATACATTTACCTGCCCTCTGGG - Intergenic
1131229747 15:90651344-90651366 AAAAGATTTCCCATCCGTCTAGG + Intergenic
1131751506 15:95512837-95512859 AACAGATTTACCTTCTTGCTTGG - Intergenic
1131763032 15:95645109-95645131 AGAAGAGTACCCTTCCCTCTGGG + Intergenic
1133183839 16:4080913-4080935 AAGAAATTTCCCTTGTCTCTGGG + Intronic
1133442427 16:5832000-5832022 GACAGACATACCTTCCCTCTAGG - Intergenic
1133610900 16:7432321-7432343 AGCAGATTACCCTTCTCTCTGGG - Intronic
1134068422 16:11245380-11245402 AAGAGAGGTCCCTGCCCTCTTGG + Intergenic
1135302035 16:21338745-21338767 TACAGATGGCCCATCCCTCTAGG - Intergenic
1137568059 16:49546256-49546278 AACACATTTTCCTTCCCTACTGG + Intronic
1137849049 16:51720384-51720406 ATCAGAACTCCTTTCCCTCTAGG - Intergenic
1140094854 16:71866262-71866284 AACATATTTCCCTTCTTCCTGGG + Intronic
1140611228 16:76601687-76601709 AAGAGATTTCTCTTCCCTCCTGG + Intronic
1140839971 16:78829409-78829431 AACTGATTGCCCTGCCCTGTAGG - Intronic
1143265607 17:5634817-5634839 TCCAGATTTCCCCTCCCTTTAGG + Intergenic
1143511957 17:7401341-7401363 GACAGATATCCCCTCCCTCAAGG - Intronic
1145734664 17:27219377-27219399 ATCACATTTTCCTTTCCTCTAGG + Intergenic
1145944203 17:28760746-28760768 ATCAGCTTTCCCTTGCATCTTGG + Intronic
1148139938 17:45321212-45321234 AGCAGTTTTCCTTTCCCTGTCGG + Intergenic
1148884804 17:50764625-50764647 CACTCCTTTCCCTTCCCTCTGGG - Intergenic
1150537302 17:66056241-66056263 GACAGATTTCTGTTGCCTCTGGG - Intronic
1150935060 17:69626461-69626483 AACAGATTATCATTCCATCTAGG - Intergenic
1151216277 17:72578869-72578891 CACATATTTCCCTCCCTTCTTGG - Intergenic
1151464658 17:74276709-74276731 AACAGCTTTGCTTTCCTTCTTGG - Intronic
1153707351 18:7759452-7759474 AACAGAACTCCCTACTCTCTTGG + Intronic
1155085295 18:22452358-22452380 GACAGATGGCCCGTCCCTCTAGG - Intergenic
1156446885 18:37243305-37243327 AACAAATTTCCAGTTCCTCTAGG - Exonic
1156608893 18:38702835-38702857 ACCAGCTTTCTTTTCCCTCTAGG + Intergenic
1157665156 18:49479791-49479813 AACAGACTTCCCATGTCTCTGGG - Intronic
1157805285 18:50653290-50653312 GTCACATTTCCCTTACCTCTGGG - Intronic
1158636679 18:59165039-59165061 TACACATTCCCCCTCCCTCTTGG + Intergenic
1158759801 18:60371249-60371271 AACAGCTTTCTCTTCCGTGTAGG - Exonic
1159108094 18:64026635-64026657 AGCAGATTCCGCTTCCCTCACGG + Intergenic
1161549369 19:4902960-4902982 AACAGTTTTGCCTCCCCTCCTGG - Intergenic
1161747209 19:6068344-6068366 AACACAATTCCCTGCCCTCATGG + Intronic
1162825201 19:13247080-13247102 AAGAGATGGCCCTCCCCTCTGGG + Intronic
1163602397 19:18257010-18257032 TTCAGAGTTCTCTTCCCTCTGGG + Intergenic
1164253200 19:23503073-23503095 AACAGAATTACCTTCAGTCTTGG - Intergenic
1164426432 19:28146009-28146031 AACTGTTCTCCCTTCCATCTTGG + Intergenic
1165022934 19:32938451-32938473 CACAGCCTTCCCTTTCCTCTAGG - Intronic
1166531884 19:43547793-43547815 CCCAGAATTCCCCTCCCTCTTGG + Intronic
1166597270 19:44060821-44060843 ACCTGAATTCCCTTCCCTTTGGG - Exonic
1166867499 19:45848945-45848967 CCCTGATTTCCCTTCCCTCCTGG - Intronic
1167334020 19:48873612-48873634 AATTGACTTCCCTGCCCTCTAGG - Exonic
1167839116 19:52099407-52099429 TAGAGATTTCCCTTTCCTATAGG - Intergenic
1167843625 19:52141740-52141762 CAGAGATTTCCTTTCCCTATGGG - Intergenic
926014566 2:9438178-9438200 TACAGATTTCCTTTTCATCTGGG - Intronic
926020231 2:9488125-9488147 AACCGATTTCTCTCCCTTCTAGG + Exonic
926580501 2:14629164-14629186 ATCCCATTTCCCTTCCTTCTGGG - Intergenic
927807841 2:26163591-26163613 TACAGATTTCCCTCTTCTCTGGG - Intergenic
929275407 2:40020140-40020162 AACAAATTTACCTTCACTCAGGG - Intergenic
931007972 2:57874315-57874337 AACAAATTTGTCTTCCCTGTTGG - Intergenic
931980007 2:67684631-67684653 AAATCACTTCCCTTCCCTCTTGG - Intergenic
933205970 2:79508433-79508455 AATAGATTTACTTTCCCTTTAGG - Intronic
933314503 2:80700015-80700037 ACCAGATGTCCCTTCCTTCCAGG - Intergenic
933665495 2:84961186-84961208 AAAACACTTCCCTTCACTCTGGG + Intergenic
936012958 2:108936639-108936661 GACAGACCTCCCTTCCCTGTAGG + Intronic
936230073 2:110692792-110692814 GCCATATTTCCCTTACCTCTAGG + Intergenic
938100718 2:128496326-128496348 AGCAGATTTCCCTTCCAAATGGG + Intergenic
939438595 2:142211520-142211542 AACTTATTTCCCATTCCTCTTGG - Intergenic
939998067 2:148938717-148938739 AAGAGATTTCCCTTCAGGCTGGG + Intronic
940895062 2:159073391-159073413 GACTGACTTCCCTTTCCTCTGGG - Intronic
943488304 2:188517070-188517092 AACAAATTTCCCTGCCCTTATGG - Intronic
944508836 2:200444571-200444593 CACAGATTTCCCTTTCCTCTTGG - Intronic
944999707 2:205335512-205335534 AACATATATCTCTTGCCTCTTGG - Intronic
946807714 2:223487999-223488021 AAGAGATTCCTCTTCTCTCTGGG + Intergenic
946953194 2:224899425-224899447 AACAAAATTCCATGCCCTCTTGG + Intronic
947571615 2:231240176-231240198 AACAGATTTATTTTCCTTCTAGG - Intronic
947849133 2:233270814-233270836 AAAAGAGTTTCCTTCGCTCTAGG + Intronic
948798762 2:240420625-240420647 ACCAGATTCCCGGTCCCTCTGGG - Intergenic
1169179467 20:3550776-3550798 TACACATCCCCCTTCCCTCTGGG + Intronic
1172298273 20:33829471-33829493 AACTGATTTCCCTTCTGTATTGG + Intronic
1172792088 20:37512735-37512757 AACAGAGTTCCTTTCCTTCTAGG + Intronic
1173841655 20:46161240-46161262 GGCAGATTTCTCTTCCCTTTTGG + Intergenic
1173998480 20:47357577-47357599 TACAAACTTCCCTTCCCTCCCGG + Intergenic
1174086652 20:48013494-48013516 CACAGATGTCCCCTCCATCTGGG - Intergenic
1174665242 20:52251946-52251968 AACAGACATCATTTCCCTCTGGG + Intergenic
1174685946 20:52455196-52455218 AAGAGATTGCTCTTCCTTCTGGG + Intergenic
1174708463 20:52680972-52680994 AATAGCTTTCCCTTCCTTTTTGG - Intergenic
1178371131 21:32028518-32028540 AACAGTTTTCTCTGTCCTCTAGG + Intronic
1178371138 21:32028568-32028590 AACAGTTTTCTCTGTCCTCTAGG + Intronic
1179127235 21:38600985-38601007 ATTAGATTTCCTTTCTCTCTGGG + Intronic
1179282627 21:39947177-39947199 TACACATTCCCCTTCCCTCTTGG + Intergenic
1179827719 21:43976763-43976785 CCCAGTTCTCCCTTCCCTCTGGG - Intronic
1181568105 22:23751742-23751764 AACACATTCCTCTTCCCTCCCGG - Intergenic
1181918307 22:26298669-26298691 GACAGATTGGCCTTCTCTCTGGG - Intronic
1181944322 22:26504027-26504049 AATAGATTTCCATTTCCACTTGG + Intronic
1182256725 22:29044526-29044548 AACAGAGTTCCCTTGGCTCTTGG + Intronic
1182880246 22:33726825-33726847 GACAGAATTCCCTCCCCACTCGG + Intronic
1184108821 22:42383635-42383657 ACCAGCTTTCCCTTCCCTGCAGG + Exonic
1185333944 22:50263262-50263284 AATAGCTTTCCTTTCCCTCCTGG - Intergenic
949864260 3:8534224-8534246 ATCAGTTTTCCCTTCTCTCAAGG + Intronic
949869308 3:8574249-8574271 ATCAGAGTACCCTGCCCTCTGGG - Intergenic
950705835 3:14780948-14780970 AAATGATTTCCCTTCCTTCTGGG + Intergenic
951805712 3:26641495-26641517 CCCAGATTTCCCTTTCCTGTGGG - Intronic
952207489 3:31194507-31194529 AAAAGATTTCTCTTCCTTCTTGG - Intergenic
952904740 3:38132278-38132300 AACAGGCTTCCCTTGCCTTTGGG - Intronic
953443787 3:42944671-42944693 TAAAGCTTTCTCTTCCCTCTTGG + Intronic
955079935 3:55649141-55649163 ATAAGACTTCACTTCCCTCTAGG + Intronic
956062458 3:65361453-65361475 AACAGAAATCCCTGCCCTCATGG + Intronic
956594829 3:70955536-70955558 AACAGATTTTCTTTACATCTTGG + Intronic
958656564 3:97009834-97009856 AACAGACTCCCCTTCCCTTGTGG + Intronic
958916341 3:100054686-100054708 CACTGATTTCCCTTCCCTCTGGG + Intronic
959426035 3:106189855-106189877 AACAAAGTTCCATTCCCTCTAGG + Intergenic
959479198 3:106850699-106850721 AACAGATTTCCCCTGCTTCCTGG - Intergenic
962230047 3:133656708-133656730 AACCTATTTTGCTTCCCTCTTGG - Exonic
962723822 3:138201973-138201995 AACAGAGTTCCTTACCCTCAGGG - Intronic
963801880 3:149684352-149684374 CATACATTTCCCTTCCCTGTAGG - Intronic
965519268 3:169657090-169657112 TACAGATCCCCCTTCCCTATTGG - Intronic
968789057 4:2646994-2647016 AACAGGTTTCCCATCCCTTCCGG - Intronic
969981719 4:11163603-11163625 AACAGATTTGCCTTTATTCTTGG - Intergenic
970213634 4:13736237-13736259 AACATATTTCCCTCTGCTCTAGG - Intergenic
970844679 4:20522503-20522525 AACAGAGTACTCCTCCCTCTGGG - Intronic
970845965 4:20537784-20537806 AGCACATTTCCATTCCCCCTAGG + Intronic
972583421 4:40415373-40415395 AAAAAAGCTCCCTTCCCTCTAGG - Intergenic
973152743 4:46908689-46908711 AACGTCTTTCCATTCCCTCTGGG + Intronic
974310578 4:60204251-60204273 AACATATTTCTCTTCCCTAAAGG + Intergenic
976730122 4:88253160-88253182 AACTGGTTTCCCTTGCCTTTGGG - Intergenic
976774301 4:88690337-88690359 AGCTGATTTCCCTTCCCTCCTGG + Intronic
982304791 4:153919466-153919488 CACTTATTTCCTTTCCCTCTTGG - Intergenic
982422760 4:155216874-155216896 TAAAGATTTACCCTCCCTCTTGG + Exonic
984017646 4:174444979-174445001 AACAGAATTCCTTTACCTCAAGG - Intergenic
985305757 4:188537845-188537867 GACAGATTTCCCTCCTCTCCTGG + Intergenic
985745405 5:1643987-1644009 AACAGTTTTTCCTCCACTCTTGG - Intergenic
986254570 5:6091510-6091532 AACAATGTTCCCTCCCCTCTGGG - Intergenic
989099519 5:37811088-37811110 AACAGCATGGCCTTCCCTCTGGG + Intergenic
989945431 5:50221908-50221930 AAGATATTTCCTTTTCCTCTAGG + Intergenic
992199113 5:74367032-74367054 AAAATATGTCCATTCCCTCTTGG + Intergenic
993514440 5:88813367-88813389 AACTAATTTCCCTACCCTGTAGG - Intronic
993952654 5:94195487-94195509 AACAGATTTAGGTTCCCTGTTGG + Intronic
994293643 5:98062159-98062181 ATCATATTTTCCTTCCCTTTTGG - Intergenic
996612246 5:125395930-125395952 AGCAGATTTTCCTTCTCACTGGG + Intergenic
996963273 5:129277469-129277491 AACAGCTGTCCCTTCCATCAGGG - Intergenic
997553862 5:134777745-134777767 TAAAGATTTCCGTTTCCTCTTGG + Intronic
998916283 5:147015092-147015114 AACAAAAATCCCTGCCCTCTTGG - Intronic
1000826278 5:166048288-166048310 AAGAGAGTTCCCTTTTCTCTAGG - Intergenic
1000883001 5:166718727-166718749 GAGAGTTTTTCCTTCCCTCTGGG + Intergenic
1000986637 5:167867816-167867838 AACAGATCTCTCTCGCCTCTGGG + Intronic
1001138660 5:169124423-169124445 AAAAGAGCTCCCTTTCCTCTGGG + Intronic
1001975882 5:175998008-175998030 AACGGATTTACCCTCCCACTTGG + Intronic
1002241544 5:177845764-177845786 AACGGATTTACCCTCCCACTTGG - Intergenic
1004200808 6:13546244-13546266 AACAAATTTCACTTCTCCCTAGG + Intergenic
1004348236 6:14868086-14868108 AACAGAATTTCCTTCCCCCATGG - Intergenic
1004438540 6:15622782-15622804 AACAGAATTGCTTTTCCTCTGGG - Intronic
1005592127 6:27339441-27339463 AACAGATTCCCACTCCCTCAAGG - Intergenic
1006172882 6:32105210-32105232 AACACTGTTCCCTTCTCTCTTGG + Intronic
1007678831 6:43620669-43620691 AACATCTTTCCCTTTCCTCCTGG + Exonic
1007990459 6:46249809-46249831 AACAGGATTCTCTTCACTCTGGG + Intronic
1009868626 6:69429317-69429339 ACCAGATTTCTCTCCCATCTGGG - Intergenic
1010999742 6:82574472-82574494 AACCTATTTCCTTTTCCTCTTGG + Intergenic
1011983359 6:93414634-93414656 AAAACGTTTCCCTTCCCTCCAGG - Intronic
1012741560 6:103022043-103022065 AACAGATTGCCCTTCCTAATTGG + Intergenic
1014127766 6:117796064-117796086 TGCAGATTTCCCTTCTCTTTTGG + Intergenic
1014556454 6:122846571-122846593 AAAAGATTTCCTTTGCCTATTGG - Intergenic
1015160556 6:130148379-130148401 AACAGACTGCCGTGCCCTCTTGG + Intronic
1016617266 6:146065768-146065790 AACAGATGTCCACTCCCTATGGG + Intronic
1017538818 6:155378565-155378587 AAAAGATCTCTCTTTCCTCTGGG + Intergenic
1018169020 6:161129579-161129601 AACAGACATCCCTGCCCTCATGG + Intergenic
1018615673 6:165684229-165684251 TACAAATATCCCTGCCCTCTGGG - Intronic
1020701661 7:11491746-11491768 AACAGAATTCCGTTTACTCTGGG + Intronic
1022129430 7:27390805-27390827 AACAGAACTCCCTACCCTCATGG - Intergenic
1022392709 7:29957534-29957556 AAGATATCCCCCTTCCCTCTTGG - Intronic
1022421976 7:30231815-30231837 AACAGAATTTCCTTCCCTGGAGG + Intergenic
1022778906 7:33558209-33558231 TACTGTTTTCCCTTCCCACTAGG - Intronic
1023477123 7:40592860-40592882 AACTGATATCCCTGACCTCTAGG - Intronic
1024565668 7:50677998-50678020 AACATGTTTTCATTCCCTCTGGG + Intronic
1026399044 7:69990305-69990327 AGCATATTTCCCTTCCCTCTGGG - Intronic
1027143296 7:75676235-75676257 GACAGATTTCCTTAACCTCTTGG + Intronic
1029605885 7:101599166-101599188 ATCTGAGTTCCATTCCCTCTGGG - Intergenic
1030171309 7:106605683-106605705 AAAAAATTTCCCTTACTTCTAGG + Intergenic
1030314813 7:108103729-108103751 AACAGACTGCCTTTCCCTCCAGG - Intronic
1030909048 7:115224036-115224058 CACAGATTTTCCTTCCTTTTGGG - Intergenic
1031222354 7:118985228-118985250 AATGGATTTCCCTTTTCTCTTGG + Intergenic
1034610447 7:152362914-152362936 ATCAGAATTCCTTTCCTTCTGGG + Intronic
1035432532 7:158833042-158833064 AACAGAATGGCCTTCCTTCTGGG - Intergenic
1036612938 8:10365726-10365748 GACAAATCTCCCTTCCCTATAGG - Intronic
1036950466 8:13134390-13134412 GACAAATATCCCTTCCCTCCTGG + Intronic
1037765586 8:21770490-21770512 AACATGTGTGCCTTCCCTCTGGG + Intronic
1037971710 8:23176714-23176736 AGCAGTACTCCCTTCCCTCTGGG + Intergenic
1038893646 8:31755934-31755956 AACAGATTTTCTTCCCCTCTTGG - Intronic
1042030910 8:64474649-64474671 AAAAGATTTCCCTACCCTACAGG + Intergenic
1042175608 8:66034747-66034769 CACAGATTTCCCATCTCCCTAGG - Intronic
1043696736 8:83229138-83229160 AACAGCTTTCACTACCCTCTTGG + Intergenic
1044764906 8:95560977-95560999 AACAGATTTCATTTCCCTGCTGG + Intergenic
1045992821 8:108329705-108329727 AACAAATTTCTCTTCCTGCTAGG - Intronic
1046413847 8:113884439-113884461 GACAGGGTGCCCTTCCCTCTTGG + Intergenic
1046719834 8:117606901-117606923 AACAAATCACCCTTCCCTCCTGG + Intergenic
1046815057 8:118573800-118573822 TACAGAAGTCCCTTGCCTCTGGG - Intronic
1047042822 8:121016893-121016915 AACAGAAATTCCTCCCCTCTAGG + Intergenic
1047181886 8:122596332-122596354 CACACATTTCTCCTCCCTCTTGG + Intergenic
1047823066 8:128542452-128542474 AACAGATTTCCCAAACCGCTAGG - Intergenic
1048254243 8:132893767-132893789 AACAGTTCTCGGTTCCCTCTGGG + Exonic
1048352016 8:133624021-133624043 AACAGAATTCCCTGCCCTGGGGG - Intergenic
1051176422 9:14365482-14365504 AAAAGTTTTCCCTGCCCTGTGGG + Intronic
1051206046 9:14690170-14690192 AGCAGGCTTCCCTTCCTTCTTGG - Intronic
1052124284 9:24756091-24756113 AACAGAGTCCCCTCCTCTCTGGG + Intergenic
1052819119 9:33125033-33125055 TACAGTTATCCCTTCCTTCTAGG + Intronic
1055955711 9:81771759-81771781 AACAGATTCCACTTCATTCTAGG - Intergenic
1056877168 9:90344968-90344990 AATAAATATCCCTTCCCTTTAGG - Intergenic
1058257582 9:102788014-102788036 AAGAGAAATTCCTTCCCTCTAGG - Intergenic
1058629428 9:106971314-106971336 CACAGAATACCCTTCCCTGTAGG - Intronic
1059489880 9:114658214-114658236 GTCAGATTTGCCTTCTCTCTAGG + Intergenic
1059682660 9:116601191-116601213 TACAGATTTTCTTTCCCACTTGG - Intronic
1059762805 9:117355079-117355101 AACAAATTTCCCTTTACTCCAGG + Intronic
1060385748 9:123226714-123226736 AACAGAAATCCCTGCCCTCATGG + Intronic
1061066566 9:128281675-128281697 AACAAAAGTCCCTTCCCTCATGG + Intronic
1061265417 9:129501971-129501993 AGCACTTTTCCCTCCCCTCTTGG - Intergenic
1061793377 9:133070481-133070503 ACCTGTTTTCCCATCCCTCTCGG + Exonic
1061795984 9:133086278-133086300 ACCTGTTTTCCCATCCCTCTCGG + Intronic
1061901967 9:133677675-133677697 AACAGAGTCCCCTTCCTGCTTGG + Intronic
1186385309 X:9105021-9105043 GGCAGATATCCCTTCCCTATGGG + Intronic
1186700070 X:12081255-12081277 ACAACATTTTCCTTCCCTCTAGG + Intergenic
1186802363 X:13105979-13106001 AAAAAATTTCCCTTCACTCCTGG + Intergenic
1188604212 X:32008189-32008211 AAAAGCTTTCCCTTCCCACCAGG + Intronic
1188723455 X:33551548-33551570 GACAGCTTTCCCCTTCCTCTGGG + Intergenic
1188739221 X:33756589-33756611 CAAAGATTTCCTTTCCCACTGGG - Intergenic
1189785044 X:44551803-44551825 AGCATTTTTCCCTTCCATCTTGG + Intergenic
1189810032 X:44773277-44773299 AAAAGAATTTCCTACCCTCTTGG - Intergenic
1190684260 X:52856443-52856465 TACAGATGTCCATTTCCTCTGGG - Intergenic
1190828399 X:54039172-54039194 AACAGATTTCTATCACCTCTAGG + Intronic
1191743819 X:64464519-64464541 GACAGCTTTCCCCTCCCTCTGGG + Intergenic
1191980136 X:66916449-66916471 AACAGATTTCCCTTACACGTTGG - Intergenic
1192262361 X:69513092-69513114 AACAGAGATACCTTCCCTCCAGG - Intronic
1194431532 X:93813074-93813096 ACCAGATCTCCCTTCACTTTAGG + Intergenic
1195505207 X:105648607-105648629 GACAGATTCTCCTTCCCTCAGGG + Intronic
1195951695 X:110282106-110282128 AACAGCTTTCTCTGACCTCTAGG + Intronic
1196503202 X:116410221-116410243 AAGAGATTTCCCCTTCCACTTGG + Intergenic
1196641598 X:118068853-118068875 AACAACTGTCCCTTCCCTGTGGG + Intronic
1197026973 X:121763559-121763581 AACAGTTTTCTCCTCCCTTTGGG - Intergenic
1198705463 X:139443627-139443649 GACAGCCTGCCCTTCCCTCTGGG - Intergenic
1199519423 X:148718744-148718766 AACAGGTTTCCCTTTTCTCAAGG - Intronic
1200354926 X:155538832-155538854 ACCAAATTTTCCTTCCCTATTGG + Intronic