ID: 1065162481

View in Genome Browser
Species Human (GRCh38)
Location 10:22937466-22937488
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065162476_1065162481 4 Left 1065162476 10:22937439-22937461 CCAAGAGGGAAGGGAAATCTGTT 0: 1
1: 0
2: 3
3: 17
4: 294
Right 1065162481 10:22937466-22937488 ATGTGGGTTGGTGGAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr