ID: 1065162949

View in Genome Browser
Species Human (GRCh38)
Location 10:22942283-22942305
Sequence GAGCCTGAACACTGTGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065162943_1065162949 -9 Left 1065162943 10:22942269-22942291 CCAAGAACCCCTCAGAGCCTGAA No data
Right 1065162949 10:22942283-22942305 GAGCCTGAACACTGTGGGTGCGG No data
1065162942_1065162949 9 Left 1065162942 10:22942251-22942273 CCACTTGCTGGTTGGCTACCAAG No data
Right 1065162949 10:22942283-22942305 GAGCCTGAACACTGTGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065162949 Original CRISPR GAGCCTGAACACTGTGGGTG CGG Intronic