ID: 1065163947

View in Genome Browser
Species Human (GRCh38)
Location 10:22954957-22954979
Sequence TTACATCAGCTTTGGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065163947_1065163955 25 Left 1065163947 10:22954957-22954979 CCAGAGAACCAAAGCTGATGTAA 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1065163955 10:22955005-22955027 ATAGGAGCTCTGATGTCCCAGGG No data
1065163947_1065163949 -5 Left 1065163947 10:22954957-22954979 CCAGAGAACCAAAGCTGATGTAA 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1065163949 10:22954975-22954997 TGTAAAGTCCTAGAGTTCCAAGG No data
1065163947_1065163951 7 Left 1065163947 10:22954957-22954979 CCAGAGAACCAAAGCTGATGTAA 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1065163951 10:22954987-22955009 GAGTTCCAAGGCCTGAGAATAGG No data
1065163947_1065163954 24 Left 1065163947 10:22954957-22954979 CCAGAGAACCAAAGCTGATGTAA 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1065163954 10:22955004-22955026 AATAGGAGCTCTGATGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065163947 Original CRISPR TTACATCAGCTTTGGTTCTC TGG (reversed) Intronic
901171317 1:7259820-7259842 TTCCCTCAGCCTTTGTTCTCTGG + Intronic
902475717 1:16685782-16685804 TTACATCAGCTTTGTTATCCTGG + Intergenic
902974179 1:20076947-20076969 TCTCAGCAGCTTAGGTTCTCAGG + Intronic
907465472 1:54632512-54632534 TTACATCTACTTCTGTTCTCTGG + Intronic
908881754 1:68740675-68740697 TTCCATAAGCTTAGGCTCTCTGG + Intergenic
911333041 1:96547526-96547548 TTATATCAGTTCTGTTTCTCTGG - Intergenic
912437704 1:109673508-109673530 TCCCATCAGCTCTGGTTCTGCGG + Intronic
914786731 1:150839927-150839949 TTAAAACAGCTTTTGTTCTGAGG - Intronic
915148678 1:153811365-153811387 TTAAATCAGCTTTGATTTTGAGG + Intronic
917390031 1:174525951-174525973 TTAAATCATCTTTGGATCTCTGG + Intronic
918695136 1:187536055-187536077 TTCTATCAGTTTTGTTTCTCTGG - Intergenic
919422190 1:197383719-197383741 TTTCCTGAGCTTTGGTTTTCTGG + Intronic
920553161 1:206882077-206882099 TGACATCTGCTTGGCTTCTCGGG - Intergenic
1063496893 10:6518358-6518380 TTAAAATAGCTTTGGTTCTGTGG + Intronic
1065163947 10:22954957-22954979 TTACATCAGCTTTGGTTCTCTGG - Intronic
1069977743 10:72228538-72228560 ATACATCAGCTTTCCTTGTCAGG - Intronic
1070667309 10:78354347-78354369 TTACCCCATCTCTGGTTCTCTGG - Intergenic
1072178700 10:92957377-92957399 TTCCAGTATCTTTGGTTCTCTGG - Intronic
1072255554 10:93617068-93617090 CTACTTCTGCTTTGGATCTCAGG + Intronic
1072754038 10:98006132-98006154 TTAGAGCAGCTTTGGTTTCCTGG - Intronic
1073638791 10:105228550-105228572 TTCCCTCAGCTTTGCTTGTCTGG + Intronic
1076996561 11:299919-299941 TTTCAGCAGCTCTGGTTCTGAGG - Intergenic
1077989288 11:7388885-7388907 TGACATCAGCTTTGGTCTCCGGG + Intronic
1078890552 11:15552920-15552942 TGATCTCAGCTTTGATTCTCTGG + Intergenic
1081998177 11:47377847-47377869 TTCCATCAGCTTTGGTTTCCAGG + Intronic
1082247271 11:49939040-49939062 TTATATCAGCCATGGTTCTTAGG - Intergenic
1083214884 11:61212286-61212308 TGACATCAGCATTGGTGCTAAGG - Intronic
1083217768 11:61231115-61231137 TGACATCAGCATTGGTGCTAAGG - Intronic
1083801207 11:65047552-65047574 TTCCCGCAGCTTGGGTTCTCTGG - Exonic
1087577794 11:100011184-100011206 TTACATTAGCTATAGTTTTCTGG + Intronic
1087612304 11:100448967-100448989 TTCCAGCAGATTTGGTTCTTGGG - Intergenic
1089714056 11:120338857-120338879 TTTCTTCAGCATTGCTTCTCAGG + Intronic
1089754562 11:120677046-120677068 ACACATCAGCTTCGGTGCTCTGG - Intronic
1089907796 11:122062251-122062273 TTAAAACAGCTTTGGATTTCTGG - Intergenic
1090433833 11:126669344-126669366 TTACCTCTCCTTTAGTTCTCAGG + Intronic
1092023869 12:5224532-5224554 TTAGATAAGCTTGGCTTCTCTGG + Intergenic
1093306429 12:17526706-17526728 TTACATCTGCTGAGGTGCTCAGG - Intergenic
1093351172 12:18104532-18104554 TACCATTAGCTTTGGTTCTCAGG + Intronic
1095585101 12:43840942-43840964 TGAAAACAGTTTTGGTTCTCTGG + Intronic
1095617630 12:44210994-44211016 TTACATATGCTTTGTTTCTATGG + Intronic
1095660556 12:44728918-44728940 CTTCATCAGCTTTTGTTATCTGG - Intronic
1097422202 12:59393867-59393889 TTGAATCAGCTTTGCTTCCCAGG - Intergenic
1097766132 12:63529144-63529166 TTACATCAGCTCTGGTATCCTGG - Intergenic
1098228625 12:68350390-68350412 TGACACCATCTTTTGTTCTCTGG + Intergenic
1099013075 12:77314588-77314610 TTAAATAAGCTTTGATTCTTAGG + Intergenic
1100472218 12:94903770-94903792 TTAGATCTGGTTTGGGTCTCAGG + Intronic
1100739448 12:97575368-97575390 TGTGATCAGCTTTGGTTCTCGGG + Intergenic
1105352469 13:19628031-19628053 TTACATCTACTTCTGTTCTCTGG + Intergenic
1110370934 13:74739221-74739243 TAACATCCACTTTGATTCTCAGG - Intergenic
1111518565 13:89367314-89367336 TGACATCTGCTTGGGTTCTGGGG - Intergenic
1112223936 13:97518985-97519007 TGACATCTGCTTGGGTTCTGGGG + Intergenic
1115080863 14:29449179-29449201 TCACATTCGCTTTTGTTCTCCGG + Intergenic
1117033647 14:51703823-51703845 TGACATCAGCTATGAATCTCAGG + Intronic
1118022593 14:61733746-61733768 TTAAAGCATCTTTGGTTCTCTGG + Intronic
1120516299 14:85475121-85475143 TTTCACCAGCTTTGGTGCACTGG - Intergenic
1120626593 14:86834365-86834387 TTACATCATCTTTGAATCTGTGG - Intergenic
1120678475 14:87450854-87450876 TGTCACCAGCCTTGGTTCTCAGG + Intergenic
1124560442 15:30769090-30769112 TTACAACAGTTCTGGTTCTGGGG - Intronic
1124670770 15:31636351-31636373 TTACAACAGTTCTGGTTCTGGGG + Intronic
1125098863 15:35886877-35886899 ATGCATAAGCTTTGGGTCTCTGG + Intergenic
1126503383 15:49374207-49374229 TTATATCAGGCTTGGGTCTCAGG - Intronic
1129044630 15:72723383-72723405 TTACCTCAAATTTGGTACTCAGG + Intronic
1129571121 15:76684922-76684944 TTGCGTCATCTTTGGTTATCAGG - Intronic
1130786931 15:87108984-87109006 TTACAATTGCTTTGGTTCTTTGG - Intergenic
1138452962 16:57104746-57104768 TTACATCAGCCTGGGTGATCAGG + Intronic
1139041708 16:63006031-63006053 TAACATCTGCTTGGCTTCTCGGG + Intergenic
1141632760 16:85297366-85297388 TTACAGATGCTTTGCTTCTCTGG - Intergenic
1141649436 16:85385261-85385283 TCACATCAGCTGTGCGTCTCTGG + Intergenic
1149076294 17:52598909-52598931 TTACATTAGCTTTGCTTTGCAGG - Intergenic
1149634980 17:58159501-58159523 TTCCAACAGGTTTGGTTGTCTGG - Intergenic
1153489635 18:5633598-5633620 ATACATGAGTTTTAGTTCTCAGG - Intergenic
1155163636 18:23215531-23215553 TGACATCAGCCTCGTTTCTCTGG + Intronic
1156059821 18:33061082-33061104 ATACATCAACTTTTGTTATCAGG + Intronic
1158122781 18:54068508-54068530 TTGCCCCAGCTTTTGTTCTCAGG - Intergenic
1158326231 18:56316302-56316324 ACACATTGGCTTTGGTTCTCTGG + Intergenic
1158816369 18:61102248-61102270 ATAAAGAAGCTTTGGTTCTCTGG + Intergenic
1159243290 18:65771745-65771767 TTCAATCAGCTGTAGTTCTCAGG + Intronic
1160293587 18:77617375-77617397 TTAGATCACCTGTGGTCCTCAGG - Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1162905798 19:13823215-13823237 TTCCATCATCTTGGGCTCTCAGG + Intronic
1164568064 19:29343785-29343807 TTCCATCAGCTTTGGTCATCTGG - Intergenic
925459524 2:4048390-4048412 TGAGAGCAGCTCTGGTTCTCAGG + Intergenic
925947936 2:8883222-8883244 TTGCTTTAGCTTTGGTTCTTTGG - Intronic
927017177 2:18976749-18976771 TTATATCAGCTTTGGCTCCCTGG - Intergenic
927036309 2:19180536-19180558 TTACATTTGCTTTGGTTTTTTGG + Intergenic
929379089 2:41328475-41328497 TTACATGAGCTTTGCTCTTCTGG - Intergenic
929767948 2:44865761-44865783 TTAGATCAGCTTTAGGTCTATGG - Intergenic
930084575 2:47485953-47485975 TTACATCAGTTTTTCTTTTCTGG + Intronic
930253298 2:49060485-49060507 TCACATCAGCTTAGGTACTGGGG - Intronic
933009139 2:77035565-77035587 TTACATCATTTTTGTTTCTTGGG - Intronic
938922248 2:136005958-136005980 TTATTTCAGCTGTTGTTCTCAGG - Intergenic
940558865 2:155267766-155267788 TTACTTCAACTTTGGTTGTCTGG - Intergenic
940822165 2:158367826-158367848 ATACCTCAGCTTTAGTTCACAGG - Intronic
941219617 2:162759757-162759779 TTCCAAAAGCTTTTGTTCTCTGG - Intronic
943836237 2:192517238-192517260 TTAGATCAGCCTTGATTCTATGG - Intergenic
944561769 2:200946831-200946853 TTACATCAGCATTTCTTCTCTGG + Intronic
948133042 2:235614910-235614932 TTACAACAAATTTGGTTCACTGG + Intronic
1170871388 20:20209878-20209900 GAACATCAGCTTTTGTCCTCAGG + Intronic
1174953193 20:55066097-55066119 TTACACAATCTGTGGTTCTCAGG + Intergenic
1175046836 20:56114789-56114811 TGACATCTGCTCAGGTTCTCAGG + Intergenic
1175965326 20:62657413-62657435 TTACATCAGCTTTGGGCCTCAGG - Intronic
1177015698 21:15784008-15784030 TTCCATCACCTTTGCTTGTCTGG - Intronic
1177139472 21:17342672-17342694 TTTCTTCAGCTTTGGGACTCAGG - Intergenic
1178301710 21:31458784-31458806 CTACTTCAGCTTAGGTTCTCAGG + Intronic
1179161730 21:38904952-38904974 TACCATCAGTTCTGGTTCTCAGG + Intergenic
1181895467 22:26103781-26103803 TTTCATCAGCTTTATTTCTTGGG - Intergenic
1182567492 22:31211177-31211199 TTACATCAGATTTAGATCACAGG - Intergenic
1182743420 22:32585593-32585615 TCACATCATCCTTGGTTCACTGG - Intronic
1183015130 22:34979930-34979952 TTACAGCAGATTTGTTGCTCAGG + Intergenic
1183043546 22:35201723-35201745 TTAGATCAACTCTGTTTCTCTGG - Intergenic
1183196234 22:36355527-36355549 TTACATCAGCCCTCGTTGTCTGG - Intronic
949366611 3:3288525-3288547 TGGCATCAGCTTGGGTTCTTGGG - Intergenic
951815980 3:26755469-26755491 TTACATTGGCTTTGTTTCTCTGG + Intergenic
954198011 3:49007716-49007738 CCACATCAGCTTTGTCTCTCGGG - Intronic
955972823 3:64452692-64452714 TTATGTCAGGTTTGGTTTTCAGG - Intergenic
958019693 3:87980650-87980672 TTACATCATCCATGGTGCTCAGG + Intergenic
961682312 3:128607678-128607700 GTTCATTAGCTGTGGTTCTCAGG - Intergenic
962128851 3:132651205-132651227 TTCCCTCAGCTTTGAATCTCAGG + Intronic
967526510 3:190501087-190501109 GTTCATCAGTTTTGGTTCTAAGG - Intergenic
967549395 3:190772866-190772888 CTCCCTCAGTTTTGGTTCTCTGG + Intergenic
968732337 4:2275226-2275248 TTTCATCAGATTTGCTACTCAGG + Intronic
969184292 4:5464005-5464027 CTGCATCAGCTTTGCTTCTGGGG + Intronic
969795926 4:9528407-9528429 TGTCATCTGGTTTGGTTCTCGGG - Intergenic
969833944 4:9823353-9823375 TTTCATGAGCTTTGCTTCACAGG - Intronic
970181476 4:13401092-13401114 TTCCAACACCTTTGGTTTTCTGG + Intronic
976476262 4:85486210-85486232 TTTCATCAGCTGTGGTTTTGGGG + Intronic
977714412 4:100166125-100166147 TTTCAGCAGCTTTGGTTCCCTGG + Intergenic
978691667 4:111520085-111520107 CTACATCAGCTTTGCTGTTCAGG - Intergenic
979267753 4:118723354-118723376 GAACTTCAGCTTTGGTGCTCAGG - Exonic
980806313 4:137819005-137819027 TTCCATTAGCTTTGTTTGTCTGG + Intergenic
980817000 4:137961094-137961116 TTTCTTCATCTTTGGTGCTCAGG + Intergenic
982548297 4:156762197-156762219 TTATATCATCTTTGTTCCTCTGG + Exonic
984388033 4:179089632-179089654 TCAAATCAGCTTTGCATCTCTGG + Intergenic
984678854 4:182583151-182583173 TTACATCAGCTGTGGAGATCTGG + Intronic
985425318 4:189824684-189824706 TTACAATATCTTTGGTTCTCTGG - Intergenic
987554463 5:19429124-19429146 TTAAATCAGCTTTGCTTTTCTGG - Intergenic
988047145 5:25971144-25971166 TGACATCTGCTTTGTTTCTGAGG - Intergenic
988082975 5:26435994-26436016 ATTCCTCAGCTTTGTTTCTCTGG - Intergenic
989295222 5:39817670-39817692 TTACCTTACCTTTGGTTCTGGGG - Intergenic
994009186 5:94879827-94879849 TTCCATTAGCTTTGGGTCTCAGG - Intronic
998184379 5:139967457-139967479 CTTCATCAGCTTTTGTTGTCTGG - Intronic
999826540 5:155278780-155278802 TTCCATAAGCTTCTGTTCTCAGG - Intergenic
999891771 5:155985698-155985720 TTTCATTAGCTTTGTTTCTAGGG - Intronic
999956221 5:156704980-156705002 TCACATCAGATTTGGTTATTTGG - Intronic
1000737648 5:164925633-164925655 TTAAACCAGCTTTGTTTCCCAGG + Intergenic
1008433499 6:51448000-51448022 TTCCATCAACCTTGGTTCTATGG + Intergenic
1009496386 6:64353700-64353722 TTCCATCAGTTCTTGTTCTCAGG - Intronic
1010545493 6:77150329-77150351 CCACTTCAGCTTTGGTTCCCAGG - Intergenic
1010683548 6:78824305-78824327 TTTCCTCAGCTTTGTTTGTCTGG - Intergenic
1010915849 6:81617926-81617948 AGACATCAGATTTGGATCTCTGG + Intronic
1015210354 6:130690385-130690407 TTCCTTCAGATTTTGTTCTCTGG + Intergenic
1015840532 6:137471960-137471982 TTTCCTCAGCTCTGGTTCTGTGG - Intergenic
1016241426 6:141935754-141935776 TTGCTTCTGCTTTAGTTCTCAGG + Intergenic
1017818272 6:158030530-158030552 CCACATCCTCTTTGGTTCTCTGG + Intronic
1019107866 6:169683922-169683944 CTACAGCAGCTTTGGCTCACAGG - Intronic
1021700985 7:23319109-23319131 TTCTACCAGCTGTGGTTCTCTGG - Intronic
1023266879 7:38415836-38415858 TTGCATCACCTATGGATCTCAGG + Intronic
1023667929 7:42544014-42544036 TTTCATCAGGTTTGACTCTCAGG - Intergenic
1024105330 7:46078828-46078850 TTCCATCAGGCTTGGTTGTCTGG + Intergenic
1024642475 7:51341609-51341631 TTCTATCAGCTCTGTTTCTCTGG + Intergenic
1032856088 7:135834779-135834801 TTCCTTCAGTTTTGCTTCTCTGG - Intergenic
1033042899 7:137934495-137934517 TTTCATCAGCTGTGCATCTCAGG - Intronic
1037100282 8:15034896-15034918 TTACTTCAGTTTTGTTTATCTGG - Intronic
1037303230 8:17476422-17476444 TTCCATCAGTTTTTGTTGTCTGG + Intergenic
1039583033 8:38682420-38682442 TTACTTCAGCTGTGGTTCTGAGG - Intergenic
1041424105 8:57701291-57701313 TCATATCAGCTATGGTTATCAGG + Intergenic
1042458239 8:69030449-69030471 TTACATCTGCAGTGCTTCTCTGG + Intergenic
1042943059 8:74126973-74126995 TTCCATGAACTTTGGTTCTGTGG + Intergenic
1043024144 8:75045347-75045369 TTATGTCTGCTTTGGTTCCCTGG + Intergenic
1043128582 8:76432289-76432311 TTACTTAAGTTTTGGTGCTCAGG - Intergenic
1043149913 8:76702937-76702959 TTACAGTAGCTGAGGTTCTCAGG + Intronic
1044036752 8:87314010-87314032 TTACATGTGCTTTGGTACTCTGG - Intronic
1044046590 8:87442620-87442642 TTAAATCATCTTTGCATCTCTGG + Intronic
1045757323 8:105559649-105559671 ATACTTCAGTTTTGGTTTTCAGG + Intronic
1051138499 9:13951415-13951437 CTACATCGACTCTGGTTCTCTGG - Intergenic
1056297867 9:85210833-85210855 TTCCATTTGCTTTGGTACTCAGG - Intergenic
1058821592 9:108735780-108735802 TTGAATCAGCTTTGCATCTCTGG - Intergenic
1186606131 X:11093808-11093830 TTAAATCAGCTTTGGCTCAGAGG + Intergenic
1187607013 X:20895995-20896017 TTACTTCAAACTTGGTTCTCTGG + Intergenic
1188513063 X:30957624-30957646 TTACATCGGATTTGTTTCTCTGG - Intronic
1189315997 X:40056917-40056939 TTTCAGAAGCTTTGGTTCACAGG + Intronic
1193601792 X:83515648-83515670 TTATATCAGCATTGCTTCTTGGG + Intergenic
1195032681 X:100941779-100941801 TTCCATCACTTTTTGTTCTCAGG - Intergenic
1196640598 X:118055540-118055562 TTACATCAGTTTTGGCCCTGTGG - Intronic
1199586695 X:149422647-149422669 TTAAATCAGTCTTGGATCTCAGG - Intergenic
1200035759 X:153328725-153328747 TGCCATCAGGTTTGGCTCTCTGG - Intergenic
1200417021 Y:2922789-2922811 TTGAATCAGCCTTGCTTCTCAGG - Intronic
1200914400 Y:8558685-8558707 TTACCTCAAATTTGGTTCCCAGG + Intergenic
1201511841 Y:14772741-14772763 TTAAATCAGCCTTGCATCTCAGG - Intronic