ID: 1065166188

View in Genome Browser
Species Human (GRCh38)
Location 10:22980175-22980197
Sequence AAAAATGCTGATAATAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1070
Summary {0: 1, 1: 0, 2: 6, 3: 145, 4: 918}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065166188 Original CRISPR AAAAATGCTGATAATAATTT AGG (reversed) Intronic
901372008 1:8806919-8806941 TAAGATGCTGATGCTAATTTTGG - Intronic
901908481 1:12435197-12435219 AAAAATGGTACTAATATTTTGGG + Intronic
902992023 1:20194730-20194752 TAAAATCCTCATAATAAGTTCGG + Exonic
903074384 1:20751416-20751438 AAAAATTTTGATAAATATTTAGG + Intronic
903630888 1:24769633-24769655 AAAAATTCTGAGAATATTTAAGG + Intronic
904182006 1:28672548-28672570 AAAAATAATAATAATAATATTGG - Intronic
904212543 1:28895482-28895504 AAAAATAATAATAATAATTTGGG - Intronic
904844975 1:33404307-33404329 GAAAATGAGGAAAATAATTTTGG + Intronic
904901213 1:33858557-33858579 AAAAATGATGATCATACTTTGGG - Intronic
905607533 1:39316270-39316292 AAAAATGGTGACATTGATTTTGG + Intronic
906875207 1:49530133-49530155 GACAATGTTGATGATAATTTAGG - Intronic
906883783 1:49622327-49622349 AAAAATGGGAATAATAATGTTGG + Intronic
907509011 1:54944661-54944683 AAAAATGCAAATAATTAGTTAGG + Intergenic
907806197 1:57822959-57822981 TAAAATGAAGAAAATAATTTAGG + Intronic
908569958 1:65399212-65399234 AACAATGGGGATAATAATTTTGG + Intronic
908720937 1:67125160-67125182 ATAAATCCTGACATTAATTTGGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
908970106 1:69817877-69817899 AACAATGCTTACAATAATGTGGG - Intronic
909057275 1:70836537-70836559 AAAAATGCTTATTTTAATTAAGG + Intergenic
909480779 1:76127286-76127308 TAAAATGCTACTAATGATTTGGG - Intronic
909583196 1:77261125-77261147 AAAAATGCTAAAAAAAATTAAGG + Intergenic
909954024 1:81754857-81754879 TTAAATGCTCATAATAATTTGGG - Intronic
910339485 1:86169247-86169269 AAAAATTCTTATAATATTTTAGG + Intergenic
910478953 1:87637778-87637800 ATAATTGCTGATAATAATCATGG - Intergenic
910568450 1:88673284-88673306 AAAAATGATGTTAATAATATAGG + Intergenic
910631846 1:89363647-89363669 AAAAATGCTTAAAATATTCTTGG + Intergenic
910920355 1:92339465-92339487 AAAAATAATAATAATAATTTTGG + Intronic
911287528 1:96014739-96014761 AAAAATCCTTATAATCAGTTGGG + Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911496270 1:98635366-98635388 AATAATGGTGATAATAAAGTTGG + Intergenic
911683112 1:100741512-100741534 AAACAACCTGATAAAAATTTGGG - Intergenic
911790011 1:102002827-102002849 AAAAATGCTGTTCCTTATTTTGG + Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912843035 1:113055858-113055880 AAAAATGGTGAATATAATGTAGG + Intergenic
914413573 1:147456248-147456270 AGAACTGCAGATATTAATTTGGG - Intergenic
914824357 1:151131118-151131140 GAAACTGCTGAGAACAATTTGGG - Intergenic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
916752385 1:167734830-167734852 AAAAAGACTCATAAGAATTTAGG + Intronic
916921790 1:169476729-169476751 AATAATAATAATAATAATTTGGG + Intronic
917267696 1:173239262-173239284 AAAATTGATGCTATTAATTTGGG - Intergenic
917826378 1:178825536-178825558 AAGATTTATGATAATAATTTTGG + Intronic
918758562 1:188370807-188370829 AAAAATATTATTAATAATTTTGG - Intergenic
918923632 1:190750083-190750105 GAAAATAATTATAATAATTTAGG + Intergenic
919027108 1:192187087-192187109 AAAATTGAAGATAAGAATTTAGG - Intergenic
919270305 1:195333381-195333403 AAAATTATTGATTATAATTTTGG + Intergenic
919360958 1:196593924-196593946 AACAGTGCTTATAATAGTTTAGG - Intronic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919532594 1:198742641-198742663 AAAAATGCTGAAAATAGATTTGG + Intronic
919546746 1:198931589-198931611 AAAAACCCTGATAATTAATTTGG + Intergenic
919569993 1:199236298-199236320 AAAAAATCTGATAACAATCTAGG + Intergenic
919574186 1:199286397-199286419 AAAAATGGGGATCATGATTTGGG - Intergenic
919582101 1:199389140-199389162 ATAAATATTGAAAATAATTTAGG + Intergenic
919616793 1:199818208-199818230 AAAAATCCTTATAATGACTTAGG + Intergenic
919641087 1:200044363-200044385 AAAAATCCTTAAAATTATTTTGG - Intronic
920074830 1:203328385-203328407 ATAAATGGTGATATTATTTTAGG + Intergenic
920200097 1:204254706-204254728 AAAAATGCTTAGAATAGTATGGG + Intronic
920222572 1:204414735-204414757 AAAAAAGCTGAGAATTATTATGG - Intergenic
920791164 1:209094271-209094293 AAATATGTTGTTAATAATGTGGG + Intergenic
921924782 1:220702646-220702668 AAAAATCCAGAGTATAATTTCGG - Intergenic
921957758 1:221001677-221001699 AAATATGAAGATAATAATTTAGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922042760 1:221913029-221913051 AAAAATGTTAATATTTATTTAGG - Intergenic
922897313 1:229110426-229110448 AAATATGCTGTTAATTAATTAGG - Intergenic
923410123 1:233699726-233699748 AACAATAATAATAATAATTTTGG + Intergenic
923574232 1:235143377-235143399 AAAACTGCTAAAAAAAATTTGGG - Intronic
923763311 1:236868258-236868280 AAAAATGCTAATGATCATCTGGG - Intronic
924237643 1:242012639-242012661 AAAAATGGAGACAATTATTTTGG + Intergenic
924240709 1:242037529-242037551 AGAATAGCTAATAATAATTTGGG + Intergenic
924445448 1:244125917-244125939 AAATCTGCTGATAAGAAATTAGG - Intergenic
1062981931 10:1731496-1731518 AACAATGCTTATAAAATTTTTGG - Intronic
1063040004 10:2328158-2328180 ATATATGCTTATAATAATATAGG + Intergenic
1063040010 10:2328436-2328458 ATATATGCTCATAATAATATAGG + Intergenic
1063040011 10:2328533-2328555 ATATATGCTCATAATAATATAGG + Intergenic
1063480055 10:6367547-6367569 GAAAATGATGATGACAATTTAGG - Intergenic
1063670966 10:8099365-8099387 AATAATGCTGCTGAGAATTTGGG + Intergenic
1063930206 10:11020232-11020254 ACAAACGCTGAGAACAATTTGGG - Intronic
1064978255 10:21140964-21140986 AAAAAAGCTAATATCAATTTTGG + Intronic
1065110063 10:22431965-22431987 AAAAATGTTGATAATTGTTGAGG - Intronic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065401167 10:25303089-25303111 GTAAATGCTGATAGTAATTTAGG + Intronic
1065597679 10:27331169-27331191 AAAAATTCTTACAATAATTCTGG - Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066595271 10:37043653-37043675 AAAAATTTTGAAAAAAATTTAGG - Intergenic
1067453868 10:46399497-46399519 AAAAAATCTGATAAGAAATTGGG - Intergenic
1067516549 10:46951549-46951571 AAAAATTCTGAAGAAAATTTAGG - Intronic
1067633333 10:47985133-47985155 AAAAAATCTGATAAGAAATTGGG + Intergenic
1067645702 10:48100244-48100266 AAAAATTCTGAAGAAAATTTAGG + Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068074830 10:52239617-52239639 AAAAATGGGGAAAATTATTTAGG + Intronic
1068259752 10:54564153-54564175 TAAAATTTTGATGATAATTTTGG - Intronic
1068280520 10:54863044-54863066 AACATTGATGATAATAATATGGG - Intronic
1068367865 10:56075574-56075596 AAAAATGATGATAATGATGATGG - Intergenic
1068499828 10:57830795-57830817 AAAAAGGCTGAAAATAAATCTGG - Intergenic
1068729552 10:60341340-60341362 AATAATGATAATAATAATTGAGG - Intronic
1069293430 10:66812637-66812659 AAAAGTGCTTAGAATATTTTTGG + Intronic
1070174101 10:73955949-73955971 AAAAATCCTGATTTTGATTTTGG + Intergenic
1070187537 10:74079854-74079876 ATTAATGCTGTTAAAAATTTTGG + Intronic
1070818304 10:79339239-79339261 CAAAGTGCTGAGATTAATTTGGG + Intergenic
1070924420 10:80208888-80208910 AAAAATAATAATAATCATTTGGG + Intergenic
1071674259 10:87639831-87639853 AAAAAGGCTTATTAGAATTTAGG + Intergenic
1071915824 10:90294887-90294909 AAAAATAATGTTAATAAATTTGG + Intergenic
1072077139 10:91988203-91988225 AAAAATGCAGAGACTAATGTGGG - Intronic
1072093787 10:92156325-92156347 AAAAATGAAGATAATGATGTTGG + Intronic
1072215719 10:93285789-93285811 CAAAATAATAATAATAATTTGGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073237517 10:102030716-102030738 AATAATAATAATAATAATTTTGG + Intronic
1073260255 10:102184314-102184336 AAAAATGCTGATAATGGGTCAGG - Intergenic
1073815353 10:107200390-107200412 AAAAGTTCTGGCAATAATTTTGG + Intergenic
1074011346 10:109484289-109484311 AAAAATGCTAATACCAAGTTTGG - Intergenic
1074327583 10:112467481-112467503 AAAAAACCTCATAATATTTTAGG + Intronic
1074409003 10:113208050-113208072 AAATATGCTGATAGTATTATGGG - Intergenic
1074833883 10:117270457-117270479 AAAAATGGTAAGAAAAATTTAGG + Exonic
1075116417 10:119630697-119630719 AATTATACAGATAATAATTTTGG - Intergenic
1075250750 10:120869620-120869642 ATAAATGCTGATACTTATTAAGG + Intronic
1075468217 10:122668004-122668026 AGAAAGGCTTCTAATAATTTGGG - Intergenic
1076438262 10:130461055-130461077 AAATATAATGAAAATAATTTGGG + Intergenic
1076989532 11:264168-264190 CAAAATAATAATAATAATTTGGG + Intergenic
1077594797 11:3522720-3522742 ATAAATACTGTTATTAATTTTGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1077891294 11:6419636-6419658 AAAAATGAGGATAATAATTCTGG - Intergenic
1077908144 11:6549853-6549875 AAAAATCTTGATAAAAATTTGGG + Intronic
1078324160 11:10365684-10365706 AACAATGTTGATAAGAGTTTGGG - Intronic
1078885811 11:15498708-15498730 ATAAAAGCTGATAATAATATTGG - Intergenic
1079304872 11:19313265-19313287 TAAATGGCTGATAATAATCTAGG + Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079921418 11:26437839-26437861 AAAAATCCTAATAAAAATATTGG + Intronic
1080172556 11:29322929-29322951 AAGAATGCTGAAATTAACTTGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1081074287 11:38650041-38650063 AATAATAATAATAATAATTTAGG + Intergenic
1081154465 11:39672315-39672337 AAATATGGTTATAATAAGTTTGG + Intergenic
1081368845 11:42273233-42273255 GAAAATATTGATAGTAATTTTGG + Intergenic
1081777988 11:45689529-45689551 AAAAAAGCAGATAATAGATTTGG - Intergenic
1081924279 11:46811387-46811409 AAAAATGGTAATATTATTTTGGG - Intronic
1081924457 11:46812948-46812970 AAAAATAATAATAATAATTAAGG - Intronic
1082225222 11:49698077-49698099 AAAAATAATGATAATAATAATGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1082840104 11:57682273-57682295 AAAGATAAAGATAATAATTTGGG + Intronic
1083011027 11:59399650-59399672 AAGAATGCTCATAAGCATTTAGG - Intergenic
1083264518 11:61540468-61540490 AAAGGTCCAGATAATAATTTAGG - Intronic
1084250713 11:67896726-67896748 AAAAATACTATTATTAATTTTGG + Intergenic
1084822136 11:71699336-71699358 AAAAATACTATTATTAATTTTGG - Intergenic
1085276414 11:75302983-75303005 AATAATGATAATAATAATCTGGG - Intronic
1085605887 11:77898114-77898136 AAAAATAATAATAACAATTTGGG - Intronic
1085779965 11:79399144-79399166 AAAAATGCTGGGAATCATTTGGG - Intronic
1085792404 11:79507330-79507352 AAAAATGCTAATGAAAAGTTTGG - Intergenic
1085813937 11:79715755-79715777 AATAATGCTGATAATAAACATGG + Intergenic
1086047941 11:82554866-82554888 AAAAATTCTTATAATCACTTTGG + Intergenic
1086395278 11:86409294-86409316 AAAAATGCTGCCTATAATCTTGG + Exonic
1086433090 11:86754772-86754794 AAAGATGATTGTAATAATTTAGG - Intergenic
1086673107 11:89571201-89571223 AAAAATGCTGCCAATAAAGTGGG - Intergenic
1086728347 11:90218488-90218510 AAAAATGATGGTCAAAATTTGGG - Intronic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087017045 11:93564086-93564108 AGAAAGGCTGATGATAATTCAGG - Intergenic
1087351100 11:97033509-97033531 AAAATTGCTGATTTTGATTTTGG - Intergenic
1087770268 11:102201895-102201917 AAAAAGGCTGAGTAAAATTTGGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1087931650 11:103985358-103985380 AAAAAACTTGACAATAATTTAGG - Intronic
1088068517 11:105752615-105752637 AAAAATACAGAAAATAATTTTGG + Intronic
1088484448 11:110327392-110327414 AATAATGCTGCTATGAATTTTGG - Intergenic
1089029285 11:115307269-115307291 AAAATTGCTAAAAATTATTTGGG - Intronic
1089670697 11:120054897-120054919 AAGAATGGTGAAAATAATTCAGG + Intergenic
1089718361 11:120386269-120386291 TAAAATGCTGAAGATATTTTTGG + Intronic
1089985325 11:122807545-122807567 AAAAATAATAATAATAATTATGG - Intronic
1090511743 11:127382931-127382953 AAAAATGTTAAGTATAATTTTGG - Intergenic
1091206694 11:133826211-133826233 AAAATTGCTGAAAATACTCTAGG - Intergenic
1091504703 12:1055595-1055617 GAAGATGCTCATAATATTTTAGG + Intronic
1092315688 12:7411316-7411338 AATAATGGTAATCATAATTTGGG - Intronic
1092420966 12:8331512-8331534 AAAAATACTATTATTAATTTTGG + Intergenic
1092549146 12:9478894-9478916 AAAAAGACTGCTAATATTTTGGG - Intergenic
1092559125 12:9591345-9591367 AAAAATTCTAAAAGTAATTTTGG - Intergenic
1092578887 12:9818764-9818786 AAAAATACTGACAATTTTTTTGG - Intergenic
1092655420 12:10678991-10679013 AATATTGCTAATAATAAATTAGG + Intergenic
1092925962 12:13272498-13272520 CATAATGCTGAAAATAATTCTGG - Intergenic
1093326125 12:17776554-17776576 AAAAATCTTAATAATAATCTCGG + Intergenic
1093411756 12:18876537-18876559 AAAAATGTGGATAAAAATATAGG - Intergenic
1093924880 12:24900136-24900158 AAAAATGATATTGATAATTTAGG - Intronic
1093943251 12:25078991-25079013 AAAAAATCTGATAAAAATTTTGG - Intronic
1093990121 12:25580658-25580680 AAACAGGTTGATGATAATTTTGG - Intronic
1094263965 12:28534212-28534234 AAGAATAATGATCATAATTTAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094503848 12:31043573-31043595 AAAAAGACTGCTAATATTTTGGG + Intergenic
1095220707 12:39610524-39610546 TAAAATGCTAAGAATAGTTTTGG + Intronic
1095269582 12:40201784-40201806 CAAAATTCTGATAATTATTCTGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095379923 12:41578396-41578418 CAAAGTGCTGATATTACTTTGGG + Intergenic
1095389804 12:41692391-41692413 AAAAATAATAATAATAATTCAGG + Intergenic
1095525327 12:43118234-43118256 AAAAAGACTCATAAGAATTTAGG + Intergenic
1095815420 12:46416900-46416922 GAAAATCCTACTAATAATTTTGG + Intergenic
1095877346 12:47096017-47096039 GAAAATGCTTACAATAATTGAGG + Intronic
1095995727 12:48082206-48082228 AAAAATGCTGTGCATATTTTTGG - Intronic
1097067167 12:56329180-56329202 AAAAATGGTGAATTTAATTTAGG - Intronic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097346310 12:58497223-58497245 AAAAATGATAATAATAATAACGG + Intergenic
1097823563 12:64152218-64152240 AAAGATGATGATAATAACTGTGG - Exonic
1098026454 12:66208462-66208484 AAAAATGCTGATAATACAGCTGG + Intronic
1098376050 12:69816372-69816394 AAAGCTGCTGTTAATATTTTTGG + Exonic
1098663209 12:73126090-73126112 TCAAAAACTGATAATAATTTAGG - Intergenic
1098832242 12:75376623-75376645 AAAAAGGCTCATCAGAATTTAGG + Intronic
1098938677 12:76509662-76509684 AAAAATGATGATGATAATAATGG + Intronic
1099474453 12:83091259-83091281 CAAAATGGTGATAATATCTTGGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099508084 12:83503241-83503263 AAAAAGGCTCATCAGAATTTAGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099745831 12:86703535-86703557 AAAAATGCTACCAATCATTTGGG - Intronic
1099777067 12:87147341-87147363 AATAATAATAATAATAATTTAGG - Intergenic
1099883225 12:88494950-88494972 AAAAATGCTGAACATTATTTTGG - Intronic
1099940364 12:89180501-89180523 AAAAAGGCTCATAATATTTGGGG + Intergenic
1100000315 12:89826828-89826850 AAAAATCATGATTCTAATTTTGG - Intergenic
1100244920 12:92748056-92748078 AGAAATGATGTTAATAATTATGG + Intronic
1100329220 12:93569899-93569921 AAAAATGCTTATCGAAATTTTGG + Intronic
1100703583 12:97176464-97176486 TAAACTGCTGATAATGTTTTTGG - Intergenic
1100727054 12:97419716-97419738 TAAAATGTTTTTAATAATTTGGG + Intergenic
1100823415 12:98453111-98453133 AAAAATGCTTTCAATAATGTGGG - Intergenic
1101049883 12:100850676-100850698 AAAATTGTTGATAAAAATTTAGG + Intronic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101247809 12:102901572-102901594 AAAAGAGCTGAGAAAAATTTAGG - Intronic
1101479162 12:105080585-105080607 CAAAATGGTCATAATAATCTAGG + Intronic
1101795212 12:107966713-107966735 AATAATAATAATAATAATTTGGG - Intergenic
1102364119 12:112316685-112316707 AATAATCTTCATAATAATTTTGG + Intronic
1102827956 12:115966260-115966282 ATAAATGCTGATCATGTTTTTGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104204656 12:126627005-126627027 AAAAATGCTGCTATGAATATGGG - Intergenic
1105375206 13:19838079-19838101 AAAAATGCTGGTAATAGGCTGGG + Intronic
1105421963 13:20260912-20260934 AAAAATGCATAGAACAATTTGGG - Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105729277 13:23195718-23195740 AATTATGCTGATTATAACTTTGG + Intronic
1106232726 13:27833790-27833812 AAAAATGGGGATAATAATAGTGG - Intergenic
1106443029 13:29796735-29796757 AAAAACGCTGACAATCTTTTAGG + Intronic
1107410694 13:40155936-40155958 TAAAATACTGAAAGTAATTTGGG - Intergenic
1107708301 13:43128523-43128545 AAAAATGGAGATAATAATAATGG - Intergenic
1108633947 13:52314230-52314252 AAAAATGCTGTTATAAATTGAGG - Intergenic
1108802346 13:54115061-54115083 AAAGTTGCAGATAATAATTTAGG - Intergenic
1108915653 13:55607150-55607172 AAAAATAATAATAATAATTAAGG + Intergenic
1109232906 13:59780904-59780926 AAAAATGTGGGTAATATTTTTGG + Intronic
1109287801 13:60432354-60432376 AAAAATGCTAGTAAGAATTGGGG - Intronic
1109487254 13:63042444-63042466 AAAAATGCTGATAGTCTTTATGG + Intergenic
1109562466 13:64070366-64070388 AAAAATTATAATAATAATTAAGG - Intergenic
1110009646 13:70315598-70315620 GAAGTTGCTGATAATAAGTTTGG + Intergenic
1110031112 13:70615151-70615173 AAAAATGTCCAGAATAATTTTGG + Intergenic
1110332992 13:74294358-74294380 AAAAATTCTCTTATTAATTTGGG - Intergenic
1110336184 13:74333645-74333667 ATGAATGTTGAAAATAATTTTGG + Intergenic
1110741105 13:78998189-78998211 AAAGATGGTGATAAGTATTTAGG - Intergenic
1110776926 13:79418604-79418626 AAAAATGGTAATTATAATGTAGG - Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1110937708 13:81312768-81312790 AAAAAAACTGATTATAAATTGGG - Intergenic
1111006325 13:82254733-82254755 GAAAATGTTGAGAATAAATTTGG + Intergenic
1111134130 13:84018198-84018220 AAAAATGCTGAACACAATTTTGG + Intergenic
1111532580 13:89558357-89558379 AAAAATGCTGATATAAAATGAGG - Intergenic
1111872609 13:93852113-93852135 AAACATGATGATACTAATTATGG + Intronic
1111964194 13:94844647-94844669 AAAAATGTTTATAAAAGTTTGGG + Intergenic
1112273717 13:97995764-97995786 AATAATAATAATAATAATTTGGG + Intronic
1112652337 13:101413849-101413871 TAAAATGTTGATAACATTTTGGG + Intronic
1113344520 13:109463120-109463142 AAATATGCTGATACTTATATTGG + Intergenic
1114149741 14:20024512-20024534 ACAAATGCTGGTAAGAATATAGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114797321 14:25731153-25731175 CAAATTGCTGATGATAATGTTGG - Intergenic
1114910294 14:27185455-27185477 TAAAGTCCTGCTAATAATTTAGG + Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115370932 14:32613952-32613974 AATAGTGCTGCTACTAATTTTGG + Intronic
1115577610 14:34726251-34726273 AAAAATGTTGAGAATAAATTTGG - Intergenic
1115632949 14:35263691-35263713 AAAAATAATAATAATAATATTGG + Intronic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116196141 14:41728067-41728089 GAAAATTCTGGTAATGATTTTGG + Intronic
1116601082 14:46923828-46923850 AAATATCCTTATAATAATCTTGG + Intronic
1116627067 14:47278794-47278816 CAAAAAGCTAATAATAATGTAGG - Intronic
1116689958 14:48093166-48093188 GAAAATGCCTATAATAGTTTGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117003027 14:51390934-51390956 AAAAATGCTGCTATGAATATGGG - Intergenic
1117686887 14:58262551-58262573 AAAAAAAATGGTAATAATTTAGG - Intronic
1117769919 14:59123513-59123535 AAAAATGGGAATAATAAATTTGG + Intergenic
1117979627 14:61329619-61329641 AAAGATGCTCATTGTAATTTGGG - Intronic
1118232462 14:63966039-63966061 TAAAATGCTGTCAATAATTCTGG + Intronic
1118609661 14:67530274-67530296 AATAATGATGATAATAATTCTGG - Intronic
1118789057 14:69072240-69072262 TAACATGCTCATAATATTTTTGG - Intronic
1120059588 14:79966726-79966748 AAAGATGATTATAATAATATCGG - Intergenic
1120063425 14:80011912-80011934 AAAAGTACTGAAAATAATGTGGG - Intergenic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120120060 14:80668060-80668082 TAAAATGCTTAGAATAATGTTGG - Intronic
1120293182 14:82603964-82603986 AGAAATTCTGATCACAATTTGGG - Intergenic
1120395918 14:83966717-83966739 TAAAATGCTTATAATATTTCAGG - Intergenic
1120562938 14:86018815-86018837 AAAAAGGCTCATCAGAATTTAGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120790678 14:88578547-88578569 CAAAATTCTGATAATAACTAAGG - Intronic
1121247946 14:92476467-92476489 AAAAATACTTTTAATGATTTAGG + Intronic
1121468519 14:94132281-94132303 CAAAAAGCTCATAATTATTTAGG - Intergenic
1121586553 14:95066978-95067000 ACAAATGATGATAATAATGATGG - Intergenic
1121628591 14:95405913-95405935 AAAAATAATAATAATAATTATGG - Intergenic
1122752939 14:103952578-103952600 AAAAATGCAGTTAATATTTAAGG + Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123501907 15:20894081-20894103 AATAATGTTTATGATAATTTTGG - Intergenic
1123559160 15:21467780-21467802 AATAATGTTTATGATAATTTTGG - Intergenic
1123595391 15:21905061-21905083 AATAATGTTTATGATAATTTTGG - Intergenic
1123677036 15:22720371-22720393 AAAAGTGCTGAGAAAAATTCTGG + Intergenic
1123773867 15:23557366-23557388 AATAATAATAATAATAATTTCGG - Intergenic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1124144310 15:27108938-27108960 GAAAATGCTCATAATAAAATAGG + Intronic
1124144313 15:27109015-27109037 ACAAATGCTCATAATAATATAGG - Intronic
1124329252 15:28794648-28794670 AAAAGTGCTGAGAAAAATTCTGG + Intergenic
1124547770 15:30647797-30647819 AAAATTTATGATAATTATTTAGG - Intronic
1124647790 15:31451684-31451706 GAAACTGATGCTAATAATTTAGG - Intergenic
1124801217 15:32834654-32834676 AAAATTGCTGAAAATAATAACGG - Intronic
1125093038 15:35817198-35817220 AAAAATTCTGAGAAAAATTCTGG + Intergenic
1125453666 15:39835517-39835539 AAAGATGCTGAGAATTTTTTGGG - Intronic
1125663609 15:41413577-41413599 AATAATGATAATAATAAGTTAGG - Intronic
1126289952 15:47063291-47063313 AAAAATGCTGCTATCTATTTAGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127000912 15:54503652-54503674 AGAAATGCTGATAATGAGTTTGG - Intronic
1127002050 15:54520477-54520499 AAGAATGTTGATAATAGATTTGG + Intronic
1127324398 15:57881274-57881296 AAGCATGTTGATAATAATTGAGG - Intergenic
1127420588 15:58801404-58801426 AAAAAAGATGATAATTATATAGG + Intronic
1127811322 15:62568049-62568071 AAAAATGCTAATAATATCTGTGG - Intronic
1128297140 15:66532074-66532096 AAAACTGATGTTAATAACTTGGG + Intronic
1128440942 15:67707964-67707986 AAAAAAACTGATAAAAATGTAGG + Intronic
1130125106 15:81087232-81087254 AAAAATGCTTACAATATGTTGGG + Intronic
1130850469 15:87788769-87788791 AAAAATGTTAAAAATTATTTGGG + Intergenic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131936723 15:97514234-97514256 AATAATGATGAGGATAATTTGGG - Intergenic
1131974605 15:97932218-97932240 AAAAATGCTTATCAAGATTTAGG + Intergenic
1132420497 15:101662150-101662172 AAAAATGAAGATTATAATGTGGG - Intronic
1202967508 15_KI270727v1_random:194939-194961 AATAATGTTTATGATAATTTTGG - Intergenic
1132848806 16:2014500-2014522 AAAAATAATAATAATAATTAGGG - Intronic
1133498529 16:6343382-6343404 ACAACTGCTGAGCATAATTTAGG - Intronic
1135852174 16:25973724-25973746 ACAAATGCTGCTATTAATTCGGG + Intronic
1136644741 16:31602851-31602873 AAATATACTGCTAATTATTTAGG + Intergenic
1136660431 16:31754423-31754445 AAATATACTGGTAATTATTTAGG - Intronic
1136869038 16:33786709-33786731 AAAAAACATGATAGTAATTTTGG + Intergenic
1137241622 16:46659671-46659693 AAAGATGCTATTAACAATTTTGG - Exonic
1138408504 16:56819186-56819208 AGAAAAGCTCATAATATTTTAGG + Intronic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139181932 16:64759100-64759122 AAAAATAATAATAATAATTCAGG - Intergenic
1140554344 16:75904282-75904304 AAGAATGCTTATTTTAATTTTGG + Intergenic
1143666382 17:8364171-8364193 AAAAATAATGATAAAAATATTGG - Intergenic
1143931097 17:10426422-10426444 CAAAATGCTTTAAATAATTTGGG - Intergenic
1144141862 17:12357148-12357170 GAAAATGGTGAGAATAATATTGG + Intergenic
1145215481 17:21048512-21048534 AATAATAATAATAATAATTTTGG - Intergenic
1145873288 17:28294488-28294510 ACAAAAATTGATAATAATTTTGG + Intergenic
1147942390 17:44058258-44058280 AATAATAATAATAATAATTTGGG + Intronic
1148005659 17:44427064-44427086 AAAAATAGTAATATTAATTTAGG - Intronic
1148710228 17:49675002-49675024 AAAAATTTTGATAATAGTGTTGG + Intronic
1149060489 17:52415651-52415673 AAATATGCGGAAAGTAATTTGGG + Intergenic
1149216291 17:54358184-54358206 CAAAATGCTGATAAGCATTATGG - Intergenic
1149276759 17:55049272-55049294 AAAAATGCCTAAAATAACTTTGG + Intronic
1149337161 17:55647547-55647569 AAAAATGCTCATAATAATAAAGG + Intergenic
1149501470 17:57156097-57156119 AAAAATAATGATAATAATACAGG - Intergenic
1149572357 17:57682164-57682186 AAAAAAAATGCTAATAATTTTGG + Exonic
1151443537 17:74148897-74148919 AACAATGATCATAATAACTTAGG - Intergenic
1151477311 17:74351497-74351519 AAAAATAATAATAATAATTAGGG + Intronic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1153259702 18:3211622-3211644 AAAAATAAAGAAAATAATTTAGG - Intronic
1153315429 18:3716813-3716835 AAAAAAGTTTATAATAATATGGG - Intronic
1153390792 18:4556325-4556347 AAAAATAATAATAATAATTTAGG + Intergenic
1154142065 18:11833028-11833050 AAAAAATCTGAAAATAAATTTGG - Intronic
1155189646 18:23418345-23418367 AATAATAATAATAATAATTTTGG - Intronic
1155947023 18:31865489-31865511 TAAAATGCTAATAAGGATTTGGG - Intronic
1156077504 18:33298439-33298461 AAAAATACTCTTAATAAATTAGG + Intronic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156439773 18:37172943-37172965 AAAAATAAAGAAAATAATTTGGG - Intronic
1156578395 18:38346746-38346768 AAAAATGCTGCAAGTAATCTGGG - Intergenic
1156684296 18:39626244-39626266 GAAATTGCTGTTAACAATTTAGG + Intergenic
1156714793 18:39994946-39994968 AAAAGAACTGATAATGATTTGGG + Intergenic
1156878531 18:42046330-42046352 AAAAAAATTGATAATAGTTTTGG + Intronic
1156913973 18:42443778-42443800 ACAAATGCAAATAATATTTTGGG - Intergenic
1157017703 18:43737782-43737804 AAACGGACTGATAATAATTTTGG - Intergenic
1157525743 18:48379870-48379892 AAAGATGCTCAACATAATTTTGG + Intronic
1157845597 18:51001148-51001170 AAAAAGGCTCATTAGAATTTAGG - Intronic
1157969909 18:52254786-52254808 AGAAATGCCTATAATCATTTTGG + Intergenic
1158003972 18:52650980-52651002 CAATATGCTTTTAATAATTTAGG - Intronic
1158388643 18:57023825-57023847 AGAAATGCTGATAATAAATTAGG + Intronic
1158612048 18:58950047-58950069 AAAACTGCTAATAAAAATTTAGG + Intronic
1158748879 18:60235469-60235491 AAAAATGCTGAAAAGCATTTTGG - Intergenic
1158809031 18:61009597-61009619 AAACATGTTCCTAATAATTTGGG - Intergenic
1159262886 18:66038849-66038871 AAAAATGCTTAAGAAAATTTGGG - Intergenic
1159411377 18:68080216-68080238 GAAAATGCTTTTAATTATTTAGG - Intergenic
1159458879 18:68696470-68696492 AAAAATAGTAATAATAATTAAGG - Intronic
1159483291 18:69019206-69019228 AAAAATGCTCAAAATACATTTGG - Intronic
1159723065 18:71917701-71917723 AAAAAAACTGAAAATAATTTTGG - Intergenic
1159762255 18:72442928-72442950 AAAAAATTTGTTAATAATTTGGG - Intergenic
1159970131 18:74640467-74640489 AAAAATATAGATAATAATTTGGG + Intronic
1160136740 18:76278303-76278325 AAATATGCACATAAAAATTTTGG + Intergenic
1160304846 18:77722750-77722772 AAAAATGCTGAAAGTATTCTAGG - Intergenic
1161920863 19:7264769-7264791 AAAAATCCTGAGAATATTGTAGG - Intronic
1164460358 19:28442394-28442416 AAAAATGCCATTATTAATTTAGG + Intergenic
1164784919 19:30922612-30922634 AAAAAATCTCATAATATTTTAGG + Intergenic
1166871041 19:45871421-45871443 AAAAGGGCTAATAATAACTTAGG + Intronic
1167387821 19:49174599-49174621 AAAAATACAAATAATAAGTTGGG + Intronic
1168025695 19:53641853-53641875 AATAATAATAATAATAATTTAGG + Intergenic
1168431316 19:56283245-56283267 AATAATGATGATAATAGTATTGG - Intronic
1168438328 19:56340507-56340529 AATACTAATGATAATAATTTAGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925090810 2:1154470-1154492 AAAAACGCTGATGAGAAGTTGGG + Intronic
925548571 2:5043952-5043974 AAATATTCTGTTAATAAATTAGG + Intergenic
926255102 2:11186923-11186945 TAAAATGCTGTTTATAATATAGG - Intronic
926519422 2:13891841-13891863 AAAAATAATAATAATACTTTGGG - Intergenic
926627103 2:15101055-15101077 AAAAATGAGAATCATAATTTAGG + Intergenic
926868526 2:17386632-17386654 AAAAATAATAATAATAATCTGGG + Intergenic
927225405 2:20760255-20760277 TACAATGCTGATACTAACTTAGG + Intronic
927258399 2:21061070-21061092 AATAATGATGATAATAATAGGGG + Intergenic
927409363 2:22806848-22806870 AAAAATGCTGACAATTACATGGG - Intergenic
927508289 2:23628652-23628674 AAAAATAGTAATAATAATGTTGG + Intronic
927622100 2:24672181-24672203 AAAAATGCTTAAAATGATTATGG + Intronic
928591913 2:32825978-32826000 GAAAATGCTAATAAACATTTTGG - Intergenic
928635662 2:33243405-33243427 AAAAAAACTGATAAAAATTCTGG - Intronic
929324044 2:40584346-40584368 AAGAATATTGATAATAATTATGG - Intronic
929806268 2:45148358-45148380 AAAAATTCTGAAAATAACATTGG + Intergenic
930181529 2:48364069-48364091 AAAAATTCAGATAAAAATTTGGG + Intronic
930221599 2:48751884-48751906 GAAAATGCTAATAATAATTATGG - Intronic
930240427 2:48930494-48930516 AAAAATGCAGATTCTAATTCAGG + Intergenic
930471291 2:51817776-51817798 AAAAAGGGCTATAATAATTTAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931390011 2:61833445-61833467 AAATGTGATGATAATAATATAGG + Intronic
931578534 2:63746921-63746943 AAAATTGCTAATAAAAACTTGGG + Intronic
932128849 2:69169317-69169339 CAAAATTCTGATAATAAGTTTGG + Intronic
932348274 2:71010401-71010423 AATAATGCTGCTATGAATTTGGG - Intergenic
932351158 2:71033281-71033303 AATAATGCTGCCAAGAATTTGGG - Intergenic
932427413 2:71647732-71647754 AAGAATGTTGATAATTATTTAGG + Intronic
932610111 2:73192515-73192537 AAAAATGGTAATAATAATAATGG - Intergenic
932967178 2:76490261-76490283 AGAAATAATGAAAATAATTTTGG + Intergenic
933304515 2:80580711-80580733 AAAAATCCTAATAATAATGATGG + Intronic
933443249 2:82342076-82342098 AATAATGTAGATAATAAATTTGG - Intergenic
933843451 2:86305961-86305983 AAAAAGGCTGCTAAGAATATTGG + Intronic
934116340 2:88799190-88799212 AACAATACTTTTAATAATTTGGG - Intergenic
934626815 2:95865654-95865676 AACAATACTTTTAATAATTTGGG + Intronic
934806742 2:97235636-97235658 AATAATACTTTTAATAATTTGGG - Intronic
934830767 2:97521539-97521561 AATAATACTTTTAATAATTTGGG + Intronic
935005514 2:99072325-99072347 AAAACTGGAGATAATTATTTTGG - Intronic
935057178 2:99577678-99577700 AATGATGCTGAAAATTATTTCGG - Intronic
935389042 2:102531246-102531268 AAAAATTCTCCTAAGAATTTAGG - Intronic
935463304 2:103364661-103364683 AAAAATGCAGCTAAAAATTCTGG + Intergenic
935792355 2:106604712-106604734 TAAAATACTGAGAATCATTTCGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936920379 2:117682811-117682833 AAAAACGCTAACAATCATTTGGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937179061 2:119973427-119973449 AATAATGCTGCTAAGAATATGGG + Intronic
937351660 2:121168332-121168354 AAAAACTCTGACAATAATTATGG + Intergenic
937526756 2:122780279-122780301 AAAGATACTGATAAGAATTTAGG + Intergenic
937569897 2:123343952-123343974 AATAATGCTGATATGAATATGGG + Intergenic
937640615 2:124206695-124206717 AAAAATGTAGATTATAATTTAGG - Intronic
937657177 2:124389664-124389686 AAAAATAATAATAATAATTTAGG + Intronic
937709136 2:124958872-124958894 AAAAATGCTTTCAATTATTTTGG + Intergenic
937719646 2:125079050-125079072 AAAAAATCTGATAAAATTTTTGG - Intergenic
938621498 2:133059335-133059357 AAAAATGCTAACAATCATCTGGG - Intronic
938829518 2:135036552-135036574 AAAGATGATGAAGATAATTTTGG + Intronic
938947060 2:136222795-136222817 AAAAATTCTGACAATCATCTGGG - Intergenic
939727587 2:145742226-145742248 AATAATGCAGATATTAATATTGG - Intergenic
939841251 2:147189752-147189774 AAACCTGCTGATAATCATATGGG - Intergenic
939999539 2:148953014-148953036 AAAAATGCTGCAGGTAATTTGGG + Intronic
940091634 2:149926164-149926186 AAAAATGAGAATAATAATTCCGG + Intergenic
940239846 2:151550943-151550965 AATAATAATAATAATAATTTTGG - Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940389757 2:153118520-153118542 AAAAAGGCTAATAATAATAGTGG - Intergenic
940470370 2:154089920-154089942 ATAAATGATGTTAATAATGTAGG - Intronic
941026249 2:160459449-160459471 AAATATGCTGTTAAGAATTAAGG - Intronic
941062859 2:160867829-160867851 AACAATGCTTATAATCACTTAGG + Intergenic
941099402 2:161280409-161280431 AAAAATTCAGAAAAAAATTTTGG + Intergenic
941101312 2:161298627-161298649 AATAAAGATGAAAATAATTTGGG - Intergenic
941103655 2:161326602-161326624 AATAATGCTGCTAAGAATATTGG - Intronic
941167310 2:162096716-162096738 AATATGGCTGATAATAATTTGGG + Intergenic
941469326 2:165864884-165864906 AAAAGTGCTGAAAATACTTGAGG + Intronic
941542961 2:166809538-166809560 GAAAATGGTGAAAATTATTTAGG + Intergenic
941549193 2:166893352-166893374 AAAAATGCAAATAATTTTTTTGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941707288 2:168673133-168673155 AAATTTGATGATAATAATTTAGG - Intronic
942484609 2:176425966-176425988 AGGAATGCTAGTAATAATTTTGG - Intergenic
942502202 2:176603527-176603549 AATAATGCTAATAATACCTTGGG - Intergenic
942979745 2:182066095-182066117 CAAAAAGCTGATAAGATTTTGGG - Intronic
943295148 2:186128974-186128996 AAAAATTCTTATACTAAGTTTGG - Intergenic
943371786 2:187024574-187024596 AAAAACTCAGAAAATAATTTAGG + Intergenic
943475562 2:188350731-188350753 AAACATGATTATATTAATTTTGG + Intronic
943808085 2:192148967-192148989 AAAAATGCTGAAAATGCTGTGGG - Intronic
944048999 2:195445226-195445248 AAAAAAGTTGATACTGATTTTGG - Intergenic
944268668 2:197756804-197756826 ATAAATTCAGATAATAATTATGG + Intronic
944420257 2:199522762-199522784 AAGAATGCAGATAATATGTTTGG - Intergenic
944642335 2:201740404-201740426 AAAAATGCTTTTGATACTTTGGG - Intronic
944654300 2:201862555-201862577 AATAATGGTAATAATAATTGAGG + Intronic
944755741 2:202759994-202760016 AAAAATGCTGATAATAGGCTGGG - Intronic
945413757 2:209545043-209545065 AAAAATACTGTTAATTTTTTAGG + Intronic
945439129 2:209857930-209857952 ATAAAAACTGATAATATTTTAGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946007716 2:216539809-216539831 AAAAATGGTGATGATAATGATGG + Intronic
946232185 2:218298490-218298512 AAAAAGGGTGGTAATAATATAGG + Intronic
946713357 2:222528486-222528508 AAAAATGCTAACAATGATCTGGG + Intronic
946721947 2:222618122-222618144 AAGAATCCTTATACTAATTTTGG - Intronic
946748933 2:222873193-222873215 AATACTGCTGAAGATAATTTTGG - Intronic
946850000 2:223896653-223896675 ACACAAGCTAATAATAATTTTGG + Intronic
947026915 2:225746551-225746573 AATAATAATAATAATAATTTTGG - Intergenic
947185197 2:227448717-227448739 AAAAATGGAGAGTATAATTTGGG + Intergenic
947270950 2:228334470-228334492 ATTAATGCTGATAATTATTAGGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
948119630 2:235519768-235519790 AATAATGATAATAATAATATTGG - Intronic
1169337281 20:4766655-4766677 AGAGATTCTGATAATAATCTGGG + Intergenic
1169371698 20:5032959-5032981 GAAAATGCAGATCCTAATTTCGG + Intergenic
1169583484 20:7053760-7053782 AAAAATGCACATAAGAATCTTGG - Intergenic
1169589925 20:7129358-7129380 AATAATGGTAATAATAATTGTGG - Intergenic
1169951754 20:11052364-11052386 AAAAATGGTGATAATAATAAGGG - Intergenic
1170144399 20:13156854-13156876 AAAAATTGTAATAATTATTTTGG - Intronic
1170188600 20:13620756-13620778 AAAAGTGCTGAGAAAAATTCTGG - Intronic
1170244423 20:14204859-14204881 AAAAATGATAATAATAATTGAGG - Intronic
1170278642 20:14621114-14621136 AAAAATGAGGATAATAATACTGG + Intronic
1171979310 20:31616307-31616329 AAAAATAATAATAATAATCTGGG + Intergenic
1172737567 20:37139168-37139190 AATAATAATGATAATAATTCTGG + Intronic
1172952764 20:38732402-38732424 AAAAATGATAATAATTATTTGGG - Intergenic
1174636009 20:52000218-52000240 AAAAAGATTGATAATATTTTTGG - Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176800427 21:13423003-13423025 AAAAATATCGAAAATAATTTGGG + Intergenic
1176813017 21:13564233-13564255 AGAAATGCTGCTGATATTTTTGG + Intergenic
1177377406 21:20291245-20291267 AGAAATGCTGGTATTATTTTAGG - Intergenic
1177377488 21:20292340-20292362 AAACATGTTTATAATATTTTAGG + Intergenic
1177391032 21:20472096-20472118 AAATGTGGTGATAACAATTTCGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177426501 21:20929590-20929612 TAAAATTGTGATAAAAATTTGGG + Intergenic
1177455710 21:21334867-21334889 AAAAATATTGATAATTATTTGGG + Intronic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177673653 21:24268266-24268288 AAATATGCTGAATGTAATTTAGG + Intergenic
1177998152 21:28128984-28129006 AATAATAATAATAATAATTTTGG - Intergenic
1178091191 21:29164945-29164967 AAAAATGCTTATAATATTTACGG - Intronic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178169900 21:30028656-30028678 AGAAATGCTGATAATCAAATTGG + Intergenic
1178320114 21:31598757-31598779 AATAATAATAATAATAATTTAGG - Intergenic
1178846649 21:36179665-36179687 AAAAATGCTTATTATAAATAAGG + Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180947124 22:19702075-19702097 TTAAATGCTGGTAAGAATTTGGG + Intergenic
1182601341 22:31466701-31466723 AAAAATGCTTATGTTGATTTTGG + Intronic
1183993653 22:41616719-41616741 TAGAATGCTGAAGATAATTTTGG + Intronic
949185780 3:1189918-1189940 CAAAATGATGATATGAATTTAGG + Intronic
949301907 3:2593665-2593687 AAACATGTTGAAAATATTTTAGG + Intronic
949885758 3:8692503-8692525 AATAATGCTGCTATGAATTTGGG - Intronic
950849197 3:16045877-16045899 AAAAATGCTGATAATGTATTTGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
950993445 3:17466911-17466933 AAACAGGATGAAAATAATTTGGG + Intronic
951209678 3:19961567-19961589 GAAAATGGTGGTGATAATTTAGG - Intronic
951314471 3:21171770-21171792 AAAAATGCTGCTATTAGTGTGGG + Intergenic
951365454 3:21776306-21776328 AAAATTGCTGCAAATAATTTTGG + Intronic
951482574 3:23177357-23177379 AAAAAAAATAATAATAATTTAGG + Intergenic
951973729 3:28479400-28479422 AAAAATTGTGATAATATTTTAGG + Intronic
952018040 3:28982788-28982810 AAAAATGCATATAAATATTTTGG + Intergenic
952156339 3:30647664-30647686 AATAATAATAATAATAATTTTGG - Intronic
952648559 3:35693532-35693554 AAAATTGCTGACAATGATTCAGG - Intronic
952779622 3:37082910-37082932 AAAAATCCAGAAAATAATTTAGG - Intronic
952825792 3:37523771-37523793 AATAATGTTGATATTTATTTTGG + Intronic
952912025 3:38199217-38199239 TAAAAAGCTTTTAATAATTTAGG - Intronic
953141420 3:40232715-40232737 AAAAATGCAGATAATTCTTTGGG + Intronic
953394914 3:42560983-42561005 AAATATGCTGAGAAAAATATGGG - Intronic
953655557 3:44850341-44850363 AAAAATCCTGTAAATAATCTGGG - Intronic
953744114 3:45560148-45560170 AACAGTGCTGAAAATAGTTTGGG + Intronic
954777708 3:53034941-53034963 AATAATGATAATAATAATTTTGG + Intronic
955959203 3:64321558-64321580 AGAAATGTTGATAATAATAATGG - Intronic
956310611 3:67875150-67875172 AGAAATGCTGAAAACTATTTTGG + Intergenic
956718959 3:72101386-72101408 AGGAATGGTAATAATAATTTGGG + Intergenic
956983949 3:74674902-74674924 AAAAATGTTCACAAAAATTTTGG - Intergenic
957161314 3:76612714-76612736 AAAAATAATAATAATAATATTGG + Intronic
957175674 3:76805018-76805040 CAAAATGCTCACAATATTTTGGG - Intronic
957454773 3:80427340-80427362 ATAAATTTTGATAAAAATTTTGG + Intergenic
957498249 3:81018407-81018429 AAATATGCTGATAATATTTATGG - Intergenic
957627606 3:82673775-82673797 AAAAATGCATAAAATTATTTGGG - Intergenic
957671600 3:83312071-83312093 AAAATCTCTGATAATAATTGTGG + Intergenic
957886377 3:86293746-86293768 AAATAGGTTGACAATAATTTGGG - Intergenic
957996315 3:87694206-87694228 AAAATTTATTATAATAATTTTGG + Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958464319 3:94439725-94439747 AAAAAAAATGGTAATAATTTGGG + Intergenic
958680538 3:97325137-97325159 TAAAATGGGGATAATAATATAGG + Intronic
958934921 3:100245964-100245986 AAAAATGCTGACATCATTTTAGG - Intergenic
958987567 3:100800097-100800119 AATAATGCTGAAAATGCTTTTGG - Intronic
959115429 3:102171988-102172010 TTAAATGATGAGAATAATTTTGG - Intronic
959225365 3:103575304-103575326 AAAAATGGTGATAGTCATTTAGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
959273562 3:104245949-104245971 AGAAATGATTATAATTATTTAGG + Intergenic
959508440 3:107180672-107180694 ACTGAAGCTGATAATAATTTGGG - Intergenic
959669414 3:108958919-108958941 AAAAATGCTAATAAGAAAATTGG - Exonic
959791915 3:110372285-110372307 AAAAATGTTGATACCAAATTTGG + Intergenic
959796323 3:110432842-110432864 AACAAAGCTGACAATAAATTGGG + Intergenic
960185916 3:114638812-114638834 AAATATGTTGCTATTAATTTTGG - Intronic
960243102 3:115368920-115368942 AAGCATGCTGATAAAAATTTGGG + Intergenic
960464841 3:117984872-117984894 AAAAATGCTCATAATTGCTTGGG + Intergenic
960506085 3:118495942-118495964 AGAAATTCTGATAAGCATTTAGG + Intergenic
960776136 3:121256287-121256309 AATAATTATGACAATAATTTTGG + Intronic
960830192 3:121838058-121838080 TAAACTGATGATAATAATTGTGG + Intronic
960918865 3:122725560-122725582 AATATTGCTAATAATAATTTTGG - Intronic
960983444 3:123254104-123254126 TAAAATGTTTATAATAATTAGGG - Intronic
961273419 3:125707702-125707724 AATAATGCTGCTATGAATTTGGG - Intergenic
961398319 3:126614456-126614478 AAAATTGATGATAGTAATTATGG - Intronic
961898641 3:130190723-130190745 AAAAATACTATTATTAATTTTGG + Intergenic
961948979 3:130726709-130726731 AAATATGCTTATATTACTTTTGG - Intronic
962546896 3:136445937-136445959 TAAAATGCAGATTATCATTTGGG - Intronic
962680466 3:137794387-137794409 AATAATGATGATAATAATAATGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963076172 3:141348394-141348416 AGAAATGCTCATAATAGCTTTGG + Intronic
963265654 3:143237922-143237944 AAAAATGGGGATAATAATGGAGG + Intergenic
963524386 3:146398206-146398228 CAACATCCAGATAATAATTTGGG - Intronic
963557838 3:146816712-146816734 AAAAGAGCTGAAAACAATTTAGG - Intergenic
963570259 3:146985797-146985819 AAATATGATGATAATTATTTAGG - Intergenic
964025196 3:152064768-152064790 AAAAATGGTGATAATAGTGTTGG - Intergenic
964145860 3:153462364-153462386 AATAATAATAATAATAATTTAGG + Intergenic
964226010 3:154403025-154403047 AAAAACACTGTTAATATTTTGGG - Intronic
964228196 3:154431614-154431636 AGAAATGATGATAATAATAGGGG - Intergenic
964992512 3:162831536-162831558 AAATAAATTGATAATAATTTTGG + Intergenic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965235791 3:166119811-166119833 AAAAATGCTAATGATCATCTGGG - Intergenic
965610801 3:170542042-170542064 AAGAAAGCTAATGATAATTTAGG - Intronic
965982986 3:174715629-174715651 AGAAATGCTGTTTATAATTCAGG + Intronic
966127730 3:176599679-176599701 AATATTGCTGGTGATAATTTTGG - Intergenic
966644525 3:182229536-182229558 AAAAATGTTAATGATCATTTGGG + Intergenic
966644754 3:182232167-182232189 AAAAATGTTAATGATCATTTGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967054619 3:185820332-185820354 TAAAATGCTGTTAAAAGTTTTGG - Intronic
967116554 3:186345696-186345718 AAAAATCCTGAGAAAAATTTGGG - Intronic
967384499 3:188898222-188898244 AAAAATGTTGAGAAGTATTTGGG - Intergenic
967637145 3:191816018-191816040 AATAATGCTGCTATGAATTTTGG - Intergenic
967662840 3:192134301-192134323 ATATATGCTGTTAATAATTTGGG + Intergenic
967906587 3:194506538-194506560 ATACATGCTGAAAATATTTTGGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969225386 4:5794110-5794132 ATAAAAACTGATAATAAATTGGG - Intronic
969504034 4:7572659-7572681 AAAAATGATGCTGATGATTTAGG - Intronic
969744722 4:9061083-9061105 AAAAATACTATTATTAATTTTGG - Intergenic
969804133 4:9593222-9593244 AAAAATACTGTTATTAATTTTGG - Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970831441 4:20344981-20345003 AAAGATACTGAGATTAATTTTGG + Intronic
971002776 4:22341223-22341245 AAAAAGGCTCATCAGAATTTAGG - Intergenic
971590167 4:28457353-28457375 AAAAATTCAGATTATGATTTTGG - Intergenic
971722330 4:30261677-30261699 TAAAATGCTGATAGAAATTCTGG - Intergenic
971895323 4:32585706-32585728 AAAAATGCTTATACTAATTATGG - Intergenic
972115222 4:35623284-35623306 AATAATGCTGAAAATAAATTTGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
972952188 4:44341213-44341235 AAAAATGCTAACAATCATCTGGG + Intronic
973172437 4:47162525-47162547 GTAGATGCTGGTAATAATTTGGG - Intronic
973178075 4:47232859-47232881 AAAAATGATGATCATAATCTGGG - Intronic
973178575 4:47240335-47240357 AAGTATGCTGATAATAACTTTGG - Intronic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974096277 4:57367962-57367984 AAAAATGTTGATAATTTTTGAGG + Intergenic
974192617 4:58526771-58526793 TAAAATGGTTAAAATAATTTAGG - Intergenic
974295243 4:59989677-59989699 TTAAACGCTGATAATAATTGGGG + Intergenic
974535751 4:63172961-63172983 ATAAATTCTGATAAATATTTTGG + Intergenic
974698423 4:65405624-65405646 AAAACAGCTGTTAATAATATTGG - Intronic
974709481 4:65571954-65571976 AAAAATTTTAATAATTATTTTGG - Intronic
975188602 4:71433003-71433025 AAGAATGGAGATAAGAATTTCGG - Intronic
975244088 4:72098447-72098469 AAAAAAACTCATAATATTTTGGG - Intronic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975821059 4:78270925-78270947 ATAAATGATTATAATTATTTTGG - Intronic
976164788 4:82242713-82242735 GAAAATAGTGATGATAATTTAGG - Intergenic
976259337 4:83130641-83130663 AAAAAAGTTGAAAACAATTTAGG + Intronic
976417436 4:84794507-84794529 AAAAATACTGACCATAATTTTGG + Exonic
976426939 4:84914876-84914898 AAAATTGCTGATAAGAACATTGG - Intronic
976506994 4:85859464-85859486 AAATATGTTGATACTCATTTGGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978015005 4:103733119-103733141 TAAAATGCAGTTAATACTTTGGG - Intergenic
978182848 4:105822041-105822063 GAAAATCCTGATAATCTTTTTGG - Intronic
978265566 4:106820329-106820351 AAACATGCTGTGAATAAGTTTGG - Intergenic
978532038 4:109724896-109724918 ATAAATGCTGGTAAAAAGTTTGG + Intronic
978534914 4:109750739-109750761 AATATTGCTGTTAATAATTTTGG + Intronic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
978687614 4:111465381-111465403 ATAAATGCTTATGAGAATTTAGG - Intergenic
978740278 4:112129813-112129835 AAAAATGCAGAGTATAGTTTTGG - Intergenic
979043183 4:115826324-115826346 AAAAATGTTCAAAGTAATTTTGG - Intergenic
979084902 4:116395845-116395867 AATAATTCTGATAATATTTTAGG - Intergenic
979143090 4:117203067-117203089 ACAAATGCTGGTAAGAATTTGGG + Intergenic
979614601 4:122728020-122728042 AAAAAGTTTGATAATACTTTGGG + Intergenic
979800448 4:124902032-124902054 AAAAATACAGATAACAATTCAGG - Intergenic
980479211 4:133365080-133365102 AATACTTATGATAATAATTTTGG + Intergenic
980619477 4:135280007-135280029 AAAAAAGCTGATATTAGTCTTGG + Intergenic
980745809 4:137013648-137013670 AAAATTGTTCTTAATAATTTGGG + Intergenic
980810896 4:137877966-137877988 GAAAATATTTATAATAATTTGGG - Intergenic
981343063 4:143644938-143644960 AATTATGGTAATAATAATTTTGG - Intronic
981577041 4:146216269-146216291 AAACATACTGATAACAATTTTGG - Intergenic
981581881 4:146257627-146257649 AACAATGATGATAATAATTATGG + Intronic
981587688 4:146322152-146322174 TAACATGCTGATAAAAATTATGG - Intronic
981694314 4:147544479-147544501 CAGATTGCTGATAATAAATTAGG + Exonic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982262835 4:153510117-153510139 CCAAAGGCTGATACTAATTTGGG - Intronic
982555975 4:156865513-156865535 ACAAAAGCTGTTAACAATTTGGG + Intronic
982910441 4:161135189-161135211 AGGAATGCTAATCATAATTTGGG - Intergenic
982918364 4:161243591-161243613 ATAAACGTTGATAATCATTTTGG + Intergenic
982965458 4:161901208-161901230 AAAAATGTTACTAGTAATTTAGG - Intronic
983118391 4:163849360-163849382 AAAGATGATGATAATAATGATGG - Intronic
983154959 4:164335716-164335738 AAAAATGCTCATGATCATCTGGG - Intronic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983790247 4:171787858-171787880 GATAATGATGATAATAATGTTGG - Intergenic
983838557 4:172424991-172425013 AATAAAGCTCATAATAATGTTGG - Intronic
984032918 4:174626989-174627011 AAAAATGATGAAAATAATCTTGG - Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984448634 4:179870380-179870402 AAAAATGAGCATAAGAATTTTGG - Intergenic
984536447 4:180981824-180981846 AATAATATTGCTAATAATTTTGG + Intergenic
984566325 4:181335327-181335349 AAGAAGGTTGATTATAATTTGGG + Intergenic
984741127 4:183164535-183164557 AAAAAAGCTAAAAATAATTTTGG + Intronic
984915061 4:184715618-184715640 AAAACTGCTGATAAGAATTCTGG - Intronic
985230116 4:187806721-187806743 TAAAATGGTTATAAAAATTTAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
985798936 5:1989440-1989462 AAAATTGCTTGTTATAATTTTGG - Intergenic
986260081 5:6136542-6136564 CAAAAGGCTGAGAATACTTTTGG - Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986814000 5:11388102-11388124 TAAAATTGTGCTAATAATTTTGG + Intronic
986884260 5:12214668-12214690 AAAAATGCTTAAAATAGTTTTGG - Intergenic
987082651 5:14439369-14439391 AAAAATGAGTACAATAATTTTGG - Intronic
987110582 5:14682447-14682469 AAAAATGCTAATGATCATCTGGG - Intronic
987230487 5:15888796-15888818 CTAAATCCTGATAATAAATTTGG + Intronic
987331269 5:16859747-16859769 AATAATAATAATAATAATTTTGG + Intronic
987466945 5:18283348-18283370 AGAAATGCTCACAATCATTTGGG + Intergenic
987615805 5:20273019-20273041 CTATATGCTGATAATCATTTAGG + Intronic
987942363 5:24556492-24556514 AAAAATGTTTAAAATATTTTTGG - Intronic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988015672 5:25555482-25555504 AAAAATACTGATTTTAATTCTGG - Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988094786 5:26591478-26591500 AAAAATAATAATTATAATTTAGG + Intergenic
988551196 5:32202588-32202610 AGAAATACTGATGATACTTTAGG + Intergenic
988691693 5:33578938-33578960 AATAATAATAATAATAATTTGGG + Intronic
988878750 5:35476670-35476692 AAACATGCTTATAATCACTTTGG - Intergenic
988886242 5:35561223-35561245 AAAAATGTTTATAATAGTATTGG - Intergenic
989008963 5:36848188-36848210 TAAAAGGCAGATAATAAATTGGG + Intergenic
989214462 5:38890413-38890435 ATAAATGTTTATAAAAATTTAGG - Intronic
989394097 5:40934584-40934606 AAAAATCCTGATGATATTTGGGG - Intronic
989550074 5:42724415-42724437 AAAAATTCTGATTCTTATTTAGG + Intergenic
989781942 5:45277314-45277336 AGAAGTTTTGATAATAATTTTGG + Intronic
989980540 5:50638404-50638426 AAAATTGCTTATAATAAATTTGG - Intergenic
990331542 5:54731101-54731123 CTAAATTCTGATCATAATTTAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990756956 5:59083287-59083309 ACACATGCTGATGAAAATTTTGG - Intronic
990924563 5:61005686-61005708 AAAAATGCTCATCATCATTGAGG - Intronic
991177576 5:63707750-63707772 AAAATTGCTAAGCATAATTTGGG - Intergenic
991259019 5:64646691-64646713 AAAAATGCAGAAAATGACTTTGG - Intergenic
991399481 5:66238046-66238068 AATTATGCTGATAACAATATTGG - Intergenic
992019501 5:72607870-72607892 ATAAATGCTGATCAGAATTTAGG + Intergenic
992313107 5:75523280-75523302 AAAAATGATTTTAATACTTTAGG - Intronic
992319503 5:75598358-75598380 AAAAATTCTTATGATAATATAGG - Exonic
992410170 5:76497694-76497716 AACAATGCTGAGAATTATATGGG + Intronic
992867923 5:80976407-80976429 CCAAATGCTGTTATTAATTTTGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993082660 5:83320749-83320771 AAAAATGCTAATAATCATCTGGG - Intronic
993190699 5:84676062-84676084 AATAAAACTGATAAAAATTTTGG + Intergenic
993269542 5:85776473-85776495 AAAAATGGTGATAATAATGTTGG + Intergenic
993355419 5:86900779-86900801 AAAAATCCTGAAAAGTATTTGGG - Intergenic
993368584 5:87063291-87063313 AAAAAAGCTAATAATCATCTTGG + Intergenic
993389529 5:87301444-87301466 TAAGATGCTGATAATATTCTGGG - Intronic
993553672 5:89307928-89307950 AAAAATGTTATTAATAATTAAGG + Intergenic
993574217 5:89581251-89581273 CAAAATGCTTACATTAATTTAGG - Intergenic
993695720 5:91059360-91059382 AAAAATACTGGTAATAATGAAGG - Intronic
994005586 5:94833618-94833640 AATAATACTGGTAATAATTTAGG - Intronic
994278432 5:97868773-97868795 AAAAATACTGCTAATTATCTAGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994310701 5:98267180-98267202 AAAAATTATTATAATACTTTAGG - Intergenic
994516281 5:100776444-100776466 AAGAATGCTCTTAATAAGTTTGG + Intergenic
994680015 5:102875176-102875198 AATAATAATGATAATAATTTAGG - Intronic
994928717 5:106153469-106153491 AAAAATGCTGAATTTAGTTTAGG + Intergenic
995016835 5:107319427-107319449 AAAAAAACTGAGAATAGTTTGGG - Intergenic
995035920 5:107533769-107533791 AAAGATGCTGATATATATTTTGG - Intronic
995084162 5:108088219-108088241 AAGAACTTTGATAATAATTTAGG + Intronic
995095286 5:108228756-108228778 AGAGATCCTGATCATAATTTGGG + Intronic
995488640 5:112665706-112665728 AAAAATATTAATATTAATTTTGG + Intergenic
995945990 5:117646366-117646388 ACAATTGCTGAGAATAATTAAGG + Intergenic
996224269 5:120970873-120970895 ATAAATAATAATAATAATTTTGG + Intergenic
996293475 5:121882996-121883018 AAAGATGCTGATTATAGGTTGGG + Intergenic
996349189 5:122519622-122519644 AATAATGCTCATTATTATTTAGG + Intergenic
996988002 5:129591605-129591627 AAAAATGCTGAGTATGACTTTGG - Intronic
997042123 5:130269227-130269249 TAATATGCTAATAATATTTTAGG - Intergenic
997056989 5:130455609-130455631 TAAAATGCTGACAAAAATCTTGG - Intergenic
997821319 5:137068619-137068641 ACAAATGCTGATAATTGTTGTGG - Intronic
998441354 5:142165301-142165323 TAAAATGCAGGTAATAGTTTAGG + Intergenic
998472722 5:142395899-142395921 AAAAATGGGAATAATAATTGTGG - Intergenic
998986290 5:147761305-147761327 TAAAATTCTTATAACAATTTTGG - Intronic
999364920 5:151016582-151016604 CAAAATGGGGATAATAATGTTGG + Intergenic
999948411 5:156622463-156622485 AATAATAATAATAATAATTTAGG + Intronic
1000091854 5:157936612-157936634 AAAAATAATAATAATAATTAAGG - Intergenic
1000262225 5:159598921-159598943 AAGAATGTGGATAATAAGTTTGG - Intergenic
1000363221 5:160467339-160467361 CAAAATGGAGATAATAATTCGGG + Intergenic
1000788141 5:165571317-165571339 GAAAATGTTGATAATGATGTGGG - Intergenic
1002145163 5:177174546-177174568 AAAAATTCAGATAAGTATTTTGG - Intronic
1002765712 6:236820-236842 AAAAATGGAAATAGTAATTTGGG - Intergenic
1003219660 6:4147916-4147938 AAAAATGCTGCTATGAATGTAGG + Intergenic
1003722719 6:8722472-8722494 AAAACTGTTGGTAAGAATTTAGG - Intergenic
1003850507 6:10217758-10217780 AAAAATGGTAAAAAAAATTTGGG - Intergenic
1004813214 6:19282943-19282965 AAAAATGCTCATAATAAATAAGG - Intergenic
1005395239 6:25376074-25376096 AAAAATAATAATAATAATTCTGG - Intronic
1005908551 6:30287620-30287642 AAAAATCCTGAAGATAACTTAGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006654337 6:35577385-35577407 TTAAATGCAGAAAATAATTTGGG - Intronic
1007034147 6:38657412-38657434 AAAAATGCTTAGAATAGTTTCGG - Intergenic
1007040925 6:38721571-38721593 AAAAACCCTGCTGATAATTTGGG + Intronic
1007049831 6:38815985-38816007 AAAAATGTTCATAACATTTTGGG - Intronic
1007968459 6:46026197-46026219 AAAAATAATAATAATAATTCAGG - Intronic
1008139330 6:47813747-47813769 AAAAATGAAGATGAAAATTTAGG + Intronic
1008854979 6:56073112-56073134 AAAAAAGCTGATGAAATTTTAGG + Intronic
1009031988 6:58070237-58070259 AAAAACACTGATAATGTTTTTGG - Intergenic
1009207814 6:60824689-60824711 AAAAACACTGATAATGTTTTTGG - Intergenic
1009211509 6:60868556-60868578 AATAATCCTGGTAATAATTCTGG + Intergenic
1009294008 6:61920875-61920897 TAAAATGCTTATAATAAATTAGG + Intronic
1009473124 6:64053326-64053348 AAAATTACTGAACATAATTTTGG - Intronic
1009500746 6:64409645-64409667 AAAAATGCTCTTATTATTTTGGG + Intronic
1009577498 6:65485398-65485420 AAAAATGAGAAAAATAATTTTGG - Intronic
1009608812 6:65909612-65909634 AAAAATACTGATAACAATAAGGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009638849 6:66303880-66303902 AAAATTGCTGATAATATTATAGG + Intergenic
1009647770 6:66428670-66428692 AAAGATGCTGGGAATGATTTGGG + Intergenic
1009653796 6:66512895-66512917 AATAATGCTGCAAATAATTTGGG - Intergenic
1009693586 6:67067515-67067537 AATATTGCTGGTGATAATTTTGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1009834021 6:68974156-68974178 AAAAATATTTATAATATTTTAGG - Intronic
1010148913 6:72707289-72707311 AATTATGCTAATATTAATTTGGG - Intronic
1010226484 6:73494251-73494273 GAAAATACTGAGAATAATATTGG + Intronic
1010255932 6:73758380-73758402 AAAAATAATAATAATAATTAAGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010880830 6:81168823-81168845 AAAACTTCTGAAAACAATTTTGG - Intergenic
1010886459 6:81248644-81248666 AATAATAATAATAATAATTTGGG + Intergenic
1011163828 6:84423171-84423193 AAAAATGATGGAAATTATTTGGG - Intergenic
1011700813 6:89952636-89952658 AAAGCTGCTGCTAATAATTAGGG - Intronic
1011868123 6:91857410-91857432 AAATATGCTTATTTTAATTTTGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012092905 6:94921472-94921494 AAAAATGCTAATGACAATTTTGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012674814 6:102102089-102102111 AAAACAGTTTATAATAATTTAGG + Intergenic
1012803262 6:103862051-103862073 AAATATACTGTGAATAATTTAGG - Intergenic
1012924876 6:105257361-105257383 AATAATGATGGTAAAAATTTAGG - Intergenic
1013064671 6:106671913-106671935 AAAATTGCCGATTATAATTTTGG - Intergenic
1013240020 6:108236361-108236383 AAAAATAATAATAATAATATAGG - Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014593556 6:123303947-123303969 AAAAATGGAGAGAATAAATTTGG + Intronic
1014663972 6:124212387-124212409 GACAATGCTTAGAATAATTTGGG + Intronic
1014853011 6:126364330-126364352 AATAATGCAGATCATAATTTAGG + Intergenic
1015075224 6:129148614-129148636 CAAAATGTTGTTAATATTTTTGG - Intronic
1015238695 6:130999698-130999720 AAACATGCTAAAATTAATTTGGG + Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015307477 6:131725841-131725863 AAAAATAATAATAATAATATTGG - Intronic
1015712301 6:136155561-136155583 AAATAGGCTCATAATCATTTTGG - Intronic
1015721942 6:136251397-136251419 AGAAAAGATGATAATGATTTGGG + Intergenic
1016153740 6:140777664-140777686 AAAAATTCTGAAAATAATAGAGG + Intergenic
1016202990 6:141435220-141435242 AAATATTCTGCGAATAATTTTGG + Intergenic
1016794007 6:148098134-148098156 AAAGATGCTGATATTAGTTTTGG + Intergenic
1016876365 6:148869661-148869683 ATAAATGCTGATGCTGATTTAGG - Intronic
1016905646 6:149148159-149148181 AAAAATGCTTAAATTAAATTAGG - Intergenic
1017065119 6:150521501-150521523 AAAATTGCTGACAAAAATCTTGG + Intergenic
1017230692 6:152070148-152070170 AGAAATGGTGATATTAACTTAGG - Intronic
1017264850 6:152431470-152431492 AAAAATACTGATAACTATTAAGG + Intronic
1017331692 6:153206928-153206950 ATACATCCTGATAATGATTTTGG + Intergenic
1017680995 6:156863466-156863488 AAAGATGATGATGATAAGTTTGG + Intronic
1018040535 6:159917983-159918005 GACAATGCTGATAGTATTTTTGG + Intergenic
1018341349 6:162854524-162854546 AAAAATAATAATAATAATGTAGG - Intronic
1018493242 6:164319183-164319205 AAATATGCTAATATAAATTTAGG - Intergenic
1018776423 6:167021092-167021114 AAAAATGGAGTTAATAATTTTGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020417005 7:7958067-7958089 GAAAATGGAGATAATATTTTGGG + Intronic
1020549159 7:9577066-9577088 AAAAATACAAATAATTATTTTGG + Intergenic
1020599711 7:10257368-10257390 AACAAAGCTGATTTTAATTTTGG - Intergenic
1020998863 7:15301716-15301738 AAAAATGACTATAATAATATTGG + Intronic
1021207470 7:17801732-17801754 TCAAATGCTGATACTCATTTAGG - Intronic
1021667826 7:23004248-23004270 AGAAATGCTTAAAATACTTTAGG - Intronic
1021833368 7:24641255-24641277 TAAAATGATAAAAATAATTTTGG - Intronic
1021837014 7:24687154-24687176 AAGACTGCTGAAAATAATCTTGG - Intronic
1022021758 7:26406345-26406367 CAAAATCCTGACAGTAATTTGGG - Intergenic
1022040209 7:26573977-26573999 AAAAATACTGCTAACAAGTTTGG + Intergenic
1022291129 7:29004679-29004701 TAAAATGGGGATAAGAATTTGGG + Intronic
1022363051 7:29681740-29681762 AAAAATGTTGATGGTATTTTAGG - Intergenic
1022428263 7:30288858-30288880 AAAAATGTTGATGGTATTTTAGG + Intronic
1022894477 7:34735727-34735749 AAAACTGCTGATAAAGCTTTTGG + Intronic
1022947858 7:35305209-35305231 CAAACTGCTTATAATAATGTGGG + Intergenic
1023212734 7:37825374-37825396 AATAAGCCTGATAATAAATTTGG - Intronic
1024183444 7:46922306-46922328 TAAAATGCTGTTTATAATTTGGG - Intergenic
1024301847 7:47892921-47892943 AAAGATGCTGGTAAAGATTTTGG + Intronic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024433690 7:49323207-49323229 AAAAATGATGATGAAAATTGAGG - Intergenic
1024749371 7:52446904-52446926 AAAAATAATAATAATAATTCAGG - Intergenic
1024955947 7:54920726-54920748 AAATATTCTGATATTAATTATGG + Intergenic
1025922155 7:65923412-65923434 AAAAAAGATGATAGTAATTGGGG + Intronic
1026281206 7:68923221-68923243 AAAAATGGGGATAATTATTGAGG + Intergenic
1026489704 7:70852138-70852160 AAAAATGCTCACAATCATCTGGG + Intergenic
1027333072 7:77120552-77120574 AAAAACGCTGATATTTAATTTGG + Intergenic
1027742829 7:82033807-82033829 AAAAGTTAAGATAATAATTTTGG - Intronic
1027796272 7:82697330-82697352 AAAAATGGAGATTTTAATTTTGG - Intergenic
1027834361 7:83221065-83221087 AAAAAAGTTGACCATAATTTTGG - Intergenic
1027889886 7:83958658-83958680 AAAAAAGATGTAAATAATTTGGG - Exonic
1028300015 7:89187047-89187069 TAAAATGCTGAGAGTAAATTTGG - Intronic
1028318089 7:89428992-89429014 AAAATAGCAGAGAATAATTTGGG + Intergenic
1028531715 7:91845654-91845676 AGTAATTCTGATCATAATTTAGG + Intronic
1028661048 7:93275502-93275524 AAAAATGCTAATAATCATCTGGG - Intronic
1028696424 7:93718030-93718052 TAAAATGGTGATAGCAATTTTGG + Intronic
1028717513 7:93988740-93988762 GAAAAAGCTGAATATAATTTAGG + Intronic
1028769225 7:94597328-94597350 AAAAATATTCATAATACTTTTGG + Intronic
1028894017 7:96020705-96020727 AATAATGCTGCTAAGAATATGGG - Intronic
1029068596 7:97876727-97876749 AAAAATACTATTATTAATTTTGG + Intergenic
1029200055 7:98833413-98833435 AATAATGATGATAATGATGTTGG - Intergenic
1029782717 7:102750745-102750767 AAAAACGCTGATATTTAATTTGG - Intronic
1029891888 7:103938927-103938949 AAAAAAGCTTATAAAACTTTAGG - Intronic
1030322236 7:108181445-108181467 AATTATCCTGATAATCATTTAGG - Intronic
1030661616 7:112224836-112224858 AAAAGTCCTGAAAAAAATTTAGG + Intronic
1030928804 7:115496301-115496323 AAAAATTATGATAATAACTAAGG - Intergenic
1031011568 7:116529149-116529171 AAAAATCATGACAATAATTTTGG + Intronic
1031226421 7:119043281-119043303 AAAAATCATGATAATTATATTGG - Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031482186 7:122291208-122291230 AATATTGCTGGTAATAATCTTGG + Intergenic
1031600788 7:123706062-123706084 AATATTTCAGATAATAATTTTGG + Intronic
1031670930 7:124544648-124544670 AATAAGACTGTTAATAATTTGGG - Intergenic
1031780111 7:125951059-125951081 AAAAATACTGATGGTATTTTAGG - Intergenic
1031780495 7:125956290-125956312 AAAAATGACTAAAATAATTTAGG + Intergenic
1031808669 7:126338768-126338790 GAAAATGCTAAGAATCATTTTGG - Intergenic
1032473884 7:132199311-132199333 ACAAATGCTCATAGTAATTCCGG - Intronic
1032774504 7:135096889-135096911 AAATATGCAGAAAAGAATTTGGG + Intronic
1032837772 7:135689858-135689880 AATAATGCAGATAGTATTTTGGG + Intronic
1032863903 7:135906774-135906796 AAAAATCCTGATGGTAATATGGG + Intergenic
1032964816 7:137083961-137083983 AAAAATAATGAAAACAATTTTGG + Intergenic
1033468878 7:141625062-141625084 AAAAATGCTAACAATTATCTAGG - Intronic
1033620777 7:143060491-143060513 AAAAATGCAGATTCTGATTTAGG + Intergenic
1033875252 7:145809776-145809798 ATGAATGCTGATAATATTATTGG + Intergenic
1034067527 7:148151276-148151298 AATAATAATGATAATAATTATGG - Intronic
1034348782 7:150403406-150403428 AGAAATGCTGCTAAAAATATGGG + Intronic
1034406341 7:150905288-150905310 AAAAATTATGGTAGTAATTTGGG - Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034571087 7:151957009-151957031 AAAAATGCTGATTATAAACTGGG + Intronic
1035427655 7:158791368-158791390 AAAAATGCTGCTAAGAATGTGGG + Intronic
1035639653 8:1174734-1174756 AGTAATGATGATAATGATTTTGG - Intergenic
1035996271 8:4550994-4551016 ATAAATCCTGATATTAATTTGGG - Intronic
1036250912 8:7161920-7161942 AAAAATACTATTACTAATTTTGG + Intergenic
1036366578 8:8125535-8125557 AAAAATACTATTACTAATTTTGG - Intergenic
1036763098 8:11526233-11526255 AAAACAGCTGATAAAAATCTAGG - Intronic
1036819114 8:11925180-11925202 AATAATGCTGCTATGAATTTGGG + Intergenic
1036884311 8:12540107-12540129 AAAAATACTATTATTAATTTTGG + Intergenic
1037183847 8:16038130-16038152 TAAAATGCTGTTTATCATTTAGG - Intergenic
1037325406 8:17684022-17684044 AAAAATGCTAATGCTAGTTTAGG + Intronic
1037923205 8:22823025-22823047 AATAGGGATGATAATAATTTTGG + Intronic
1038099577 8:24358278-24358300 ATTAAAGCTGATAATAATATTGG - Exonic
1038661439 8:29500788-29500810 AAAAATGCTATTATTAATATTGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1040717770 8:50278686-50278708 AAAAATGCTAAAAAAAAATTTGG + Intronic
1040774004 8:51016695-51016717 AAAAATGCTAATAATCATGTGGG + Intergenic
1041100301 8:54390285-54390307 ACAGATGGTGATATTAATTTAGG + Intergenic
1041125508 8:54634336-54634358 AGAAATGCTGAAATGAATTTGGG + Intergenic
1041292838 8:56323362-56323384 AAAAAGTCAGATAAGAATTTAGG + Intergenic
1041961549 8:63623103-63623125 AAAAATACTGAAAAGAACTTTGG + Intergenic
1042201184 8:66280527-66280549 AAAAATGCTGAAGATTAATTTGG + Intergenic
1042429756 8:68691880-68691902 AATAATGGTAATAATATTTTAGG + Intronic
1042580628 8:70274549-70274571 AAAAATTCTCTGAATAATTTTGG + Intronic
1042756333 8:72216650-72216672 AAATTTGCTGATAATCATATTGG - Intergenic
1043003904 8:74794478-74794500 GAAAATGTTGATAAAAACTTTGG - Intronic
1043263941 8:78238406-78238428 AAACAGAATGATAATAATTTGGG + Intergenic
1043766545 8:84141115-84141137 GAAAATTCTGATAAGAATGTTGG + Intergenic
1043889186 8:85637546-85637568 AGAAATGCTGAAAATAACTATGG - Intergenic
1043997610 8:86837961-86837983 AAAAATCTAGATAATAATGTAGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044537218 8:93371050-93371072 ACAAATGTTGTTAAAAATTTTGG + Intergenic
1044690430 8:94871486-94871508 AAAAATGATAATAATAATTTGGG + Intronic
1044883437 8:96748099-96748121 AACAATGCTGATAATAAGCTGGG - Intronic
1045326002 8:101118202-101118224 AAAAATGCTCCTAAGAAATTGGG - Intergenic
1045518607 8:102883400-102883422 AATAATGCTGGTAGTAATGTAGG - Intronic
1045795030 8:106032493-106032515 TAAAATGATGAGAACAATTTTGG - Intergenic
1045895869 8:107215997-107216019 AGAAAAGCTGAAAATAAATTGGG - Intergenic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046213396 8:111110059-111110081 AAAAATAATAATAATAATTTTGG + Intergenic
1046252954 8:111657273-111657295 AATAGTGATGATAATAATTTTGG - Intergenic
1046455049 8:114448182-114448204 AACAATACAGTTAATAATTTTGG - Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046818018 8:118606855-118606877 AAAGATGCTGAAAATAAACTTGG - Intronic
1047060796 8:121222779-121222801 AAAAGTGCTGATAGAAATTAAGG - Intergenic
1047298442 8:123591594-123591616 AAAAAGGTTGAAAAAAATTTGGG - Intergenic
1047527288 8:125644414-125644436 CAAAATGACGATAATAATTCTGG - Intergenic
1047963994 8:130032168-130032190 AAAAATACACATAATACTTTGGG - Intergenic
1048540079 8:135334420-135334442 TAAAATAGTGATAATAATTAGGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1049929683 9:444348-444370 AATAATAATAATAATAATTTGGG + Intronic
1049958615 9:716429-716451 AATAATGAAGATAAAAATTTAGG - Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1051497417 9:17739278-17739300 AAAAGTGCTAATAATTACTTTGG - Intronic
1051770611 9:20574596-20574618 AAAAATGCTAATGATCATCTGGG + Intronic
1052127761 9:24799169-24799191 AAAACTGATGTTATTAATTTTGG + Intergenic
1052144591 9:25032948-25032970 AGAAATGCTGAGGATAAATTAGG + Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052422158 9:28256837-28256859 AAAAAGCCTTTTAATAATTTTGG + Intronic
1052514912 9:29467844-29467866 CAAACTGCTAATAAAAATTTAGG - Intergenic
1052572735 9:30248532-30248554 AATGATGCTGATAATACATTTGG + Intergenic
1052807998 9:33030159-33030181 AAAAGTGCTGATATTTCTTTAGG - Intronic
1052946170 9:34169940-34169962 AATAATGATAATAATAATTCTGG - Intergenic
1053127196 9:35591819-35591841 GATATTGCTGATGATAATTTTGG - Intergenic
1053224882 9:36346087-36346109 AACAATACTCAGAATAATTTAGG + Intronic
1053311163 9:37021037-37021059 GAAAATGCTAATAATAGTATGGG - Intronic
1054848138 9:69818888-69818910 AGCAATGATGATAATATTTTTGG + Intergenic
1055038350 9:71842329-71842351 AAAAATGTTGAAATTAGTTTTGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055179639 9:73368823-73368845 ATAATTGCTAATTATAATTTTGG - Intergenic
1055211182 9:73794921-73794943 AAAAATGCAGATTATGCTTTTGG - Intergenic
1056653294 9:88487574-88487596 AAAAATGTTCATAAAATTTTGGG + Intergenic
1056823146 9:89858446-89858468 AAAAATGCTGCTATGAACTTAGG - Intergenic
1057113013 9:92492183-92492205 AAATATGCTGCCAAAAATTTGGG + Intronic
1057202588 9:93150614-93150636 AATAATAATGATAATAATGTAGG - Intergenic
1057584724 9:96319065-96319087 AACAATGCTGCTATTAATATGGG - Intergenic
1058108965 9:101009289-101009311 AAAGATGCTCATAATATTTTGGG + Intergenic
1058261006 9:102831630-102831652 AAAAATGCTAACAATCATCTAGG - Intergenic
1058419679 9:104821710-104821732 AAAAATGCTCATACTAAAATTGG - Intronic
1058509598 9:105703070-105703092 ACAAATGTTGCTAAGAATTTTGG + Intronic
1058817719 9:108700910-108700932 ATAAATGATGACATTAATTTTGG + Intergenic
1058978773 9:110149874-110149896 AAAAGTTCTGAAAATTATTTTGG - Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059622076 9:116017308-116017330 AAAAATGCTACTAATTTTTTGGG + Intergenic
1059786167 9:117586936-117586958 TTACATGCTGATTATAATTTTGG + Intergenic
1059852198 9:118354928-118354950 AAAAAAGCTCATAAAAAGTTTGG - Intergenic
1059916432 9:119107629-119107651 AAAAATTATGACAATCATTTTGG - Intergenic
1060677798 9:125531661-125531683 AAAAATACTCATAATAAAATGGG - Intronic
1060902534 9:127272886-127272908 GAAAATGGTTACAATAATTTTGG - Intronic
1061826922 9:133263899-133263921 AAAAATGGAAAAAATAATTTAGG - Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1185921878 X:4102373-4102395 AATTATGATGATAGTAATTTGGG - Intergenic
1185994811 X:4934429-4934451 AAAAATGCTGAACCTAATTTTGG - Intergenic
1186344886 X:8681867-8681889 AAATATGTTGATAGTAACTTTGG - Intronic
1186398468 X:9234409-9234431 AAAAATGATGATAATATAGTTGG - Intergenic
1186842361 X:13496495-13496517 CAAAAAGCTGATTACAATTTTGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188164375 X:26843874-26843896 AAAATTGCTTATAATAAATATGG - Intergenic
1188429855 X:30094276-30094298 AAAAATGCCTATTCTAATTTGGG + Intergenic
1188649842 X:32618762-32618784 ATAAATGTTGATAACGATTTAGG + Intronic
1188679336 X:32982564-32982586 ACAAATGCTGGTAATAATGCAGG + Intronic
1189000994 X:36945884-36945906 GAAAATTCTGTTATTAATTTAGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189805918 X:44735600-44735622 AATAATGCTGCTAATAACATCGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1190574058 X:51815187-51815209 TAAAATACTGATAAAAATTATGG - Intronic
1190749728 X:53351333-53351355 AAAAATACAGAAAATTATTTGGG - Intergenic
1190890890 X:54566747-54566769 AAAAATGCTGTTATGAATATGGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192016983 X:67341763-67341785 AAAAAAGATGACAATTATTTGGG - Intergenic
1192104439 X:68300361-68300383 CAAAATGCTAATAAAATTTTTGG - Intronic
1192164666 X:68820324-68820346 AATAATAATAATAATAATTTGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193248746 X:79263082-79263104 CAAAATTGTTATAATAATTTTGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193439544 X:81522002-81522024 AAAAATGGTGACTAAAATTTTGG + Intergenic
1193454660 X:81716002-81716024 AAAAAAGCTAGTAATAATTATGG - Intergenic
1193586235 X:83325109-83325131 AAGAATGTTGAAAATAATATAGG - Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1194464570 X:94217627-94217649 TAAAATCCTGATAAAAATTTGGG + Intergenic
1194518727 X:94892113-94892135 AAAAATACTCATCAGAATTTGGG + Intergenic
1194686774 X:96928315-96928337 AATAATGGTGATAATAGTTTGGG + Intronic
1195476611 X:105293510-105293532 AAAACTGCTGACAAAGATTTGGG - Intronic
1195765644 X:108294019-108294041 ATAAATGCTGGTAGTTATTTTGG - Intronic
1196348125 X:114691989-114692011 GAAAATGAAGATAAAAATTTAGG - Intronic
1196354987 X:114780692-114780714 AATTTTGTTGATAATAATTTTGG + Intronic
1196526550 X:116734614-116734636 GAACATGCAGAAAATAATTTGGG - Intergenic
1196913382 X:120507071-120507093 AAAAATGTTTATAATATTTGAGG - Intergenic
1197069178 X:122273175-122273197 ATAAATGCTAAGAATATTTTTGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197536792 X:127699558-127699580 AAAAAGGCTGATTAATATTTAGG - Intergenic
1197537274 X:127706613-127706635 AAAAAGGCTTATCAGAATTTAGG - Intergenic
1197554623 X:127938204-127938226 AAAAAAGCTCATTAGAATTTAGG + Intergenic
1197842652 X:130765615-130765637 AATAATGCTGATGAGAATTTAGG + Intronic
1197973884 X:132144501-132144523 AAAAATACTGATAAAAATTATGG + Intergenic
1198199832 X:134404808-134404830 AAAAATGCTAACAATCATCTGGG - Intronic
1198273508 X:135078667-135078689 AAAAATGAGGATAATAATTGAGG - Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198636435 X:138706523-138706545 AAATATGCTGAAAATAATGAAGG + Intronic
1198923002 X:141751457-141751479 CAATATGCAGAAAATAATTTGGG + Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199388998 X:147257723-147257745 CAAAATGCTGATAAGAAGTTGGG + Intergenic
1199413996 X:147558714-147558736 TAAAATGCTGATACTTATCTAGG + Intergenic
1199540603 X:148953891-148953913 AAAAGTGCTGTTAAAAATCTGGG - Intronic
1201378774 Y:13349763-13349785 AAAAATTCTGAGAAAAATTAAGG + Intronic
1201467166 Y:14295263-14295285 AAAAAAGTTTATAATATTTTTGG - Intergenic
1201681541 Y:16649773-16649795 AAAAATGCTGAACCTAATTTTGG + Intergenic
1202264400 Y:23002910-23002932 AAATATGTTCACAATAATTTTGG - Intronic
1202417391 Y:24636652-24636674 AAATATGTTCACAATAATTTTGG - Intronic
1202453395 Y:25033434-25033456 AAATATGTTCACAATAATTTTGG + Intronic