ID: 1065168258

View in Genome Browser
Species Human (GRCh38)
Location 10:23003102-23003124
Sequence CAGTATTACTTTATCTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065168256_1065168258 12 Left 1065168256 10:23003067-23003089 CCTTAAGAAGGGCAGATTTGTCT 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1065168258 10:23003102-23003124 CAGTATTACTTTATCTAAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065168258 Original CRISPR CAGTATTACTTTATCTAAGA GGG Intronic
901093678 1:6661325-6661347 CAGAATCACTTTATCTCAAATGG + Intronic
901774590 1:11551565-11551587 GAGAATTACTTTAGCTAGGATGG + Intergenic
902512420 1:16973625-16973647 CAGTTTTCCTGTCTCTAAGAAGG + Intergenic
903571253 1:24307249-24307271 CAGTATTTCTCAAACTAAGATGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
904765665 1:32844564-32844586 GAGTATTACTTGAGCTAAGGAGG - Intronic
906617283 1:47242013-47242035 CAGTATCACTTTATCAAGGTAGG + Intergenic
907941442 1:59091834-59091856 CAGTTTTATTTTCTGTAAGATGG - Intergenic
910916039 1:92290360-92290382 CATTATTACTATTTTTAAGAAGG + Intronic
911868424 1:103058785-103058807 CATTATTATTATATATAAGATGG + Intronic
912022553 1:105123256-105123278 CAGCATTAATTTATTTATGATGG + Intergenic
915091002 1:153426141-153426163 AAGGATTACTTGAGCTAAGAAGG + Intergenic
918050776 1:180970861-180970883 AAGTTGTCCTTTATCTAAGAAGG + Intergenic
919257920 1:195149890-195149912 CATTATTACTTTATTTCATATGG + Intergenic
920821285 1:209383770-209383792 CACTAGGACTGTATCTAAGAAGG + Intergenic
924618567 1:245637963-245637985 CAGTATTGATTTATCTACTACGG + Intronic
924846046 1:247772711-247772733 TAGTATTATTTTATCTTAGAAGG - Intergenic
1064953992 10:20886522-20886544 CAGAATTTCTTTTTTTAAGATGG - Intronic
1065168258 10:23003102-23003124 CAGTATTACTTTATCTAAGAGGG + Intronic
1066341443 10:34538185-34538207 CAGTATTACTTTTTATGAGTGGG - Intronic
1068266941 10:54662775-54662797 TGGTATTACTTTATATAATAAGG - Intronic
1068628872 10:59279103-59279125 CAGTAATACTTTATAGAACACGG - Intronic
1069142322 10:64841257-64841279 CAGTATTTATTTGTCTAATATGG + Intergenic
1069275573 10:66587200-66587222 CAGTATTACCTTAGCTAAATAGG - Intronic
1074366980 10:112866353-112866375 TTGTATTACTTTATGTGAGAGGG - Intergenic
1075415828 10:122262922-122262944 CAGTTTTTGTTTATCTAGGAAGG + Intergenic
1076681937 10:132177170-132177192 CATTATTGCTTTAACCAAGATGG - Intronic
1078922646 11:15844929-15844951 CAGTTTCACTGTAGCTAAGAAGG + Intergenic
1079069024 11:17326912-17326934 CAGTTTTTGTTTATCTGAGAAGG + Intronic
1080980480 11:37398248-37398270 CCTTATTAGGTTATCTAAGAAGG - Intergenic
1082637311 11:55612391-55612413 CAGGTTTACTTTATTTGAGAAGG - Intergenic
1083552485 11:63600361-63600383 AAGTATTCCGTTATCTAAAAAGG + Intronic
1084622807 11:70285009-70285031 ATGTATTTCTTTATTTAAGATGG + Intronic
1088419592 11:109629672-109629694 CAGTATTACATTTTTTAAGGCGG + Intergenic
1092263685 12:6965527-6965549 CAGTCTTCCTTAATCCAAGAGGG + Exonic
1092678031 12:10944040-10944062 TAGTATTACTTTAACTATTAGGG + Intronic
1097515355 12:60597580-60597602 CAGTATTGCTTGTTCTAAAATGG + Intergenic
1097554352 12:61118480-61118502 CAGTATAGCTTTATGTAAAATGG - Intergenic
1098075727 12:66728625-66728647 GAGAATTATTTTATCAAAGAAGG + Intronic
1099566110 12:84248427-84248449 CAGTATTAGTTCATATAAAAAGG + Intergenic
1099647503 12:85378105-85378127 CTGTGTCACTTTATCTAAGTTGG + Intergenic
1100411077 12:94320607-94320629 CAGTATTTGCTTATCTAAAAAGG + Intronic
1102849727 12:116229347-116229369 CAGGTTTACTTTATATAAGTAGG + Intronic
1104778986 12:131407677-131407699 CTGTAGTAGTTTATCTAAGTTGG - Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107616507 13:42173499-42173521 CATTATTTCTTAATTTAAGAAGG + Intronic
1107704137 13:43082307-43082329 CAGTATAACTTTAAATATGATGG - Intronic
1108034253 13:46271471-46271493 CAGTTTTACTTTGTTTCAGAGGG - Intronic
1108085665 13:46789389-46789411 CGGTATTACTAGAACTAAGAAGG - Intronic
1108634874 13:52323375-52323397 CAGTACAACCTTCTCTAAGAGGG + Intergenic
1108652931 13:52499813-52499835 CAGTACAACTTTCTCTAAGAGGG - Intergenic
1108711454 13:53036813-53036835 CAGTTTTACTGTCTCTAAAATGG - Intronic
1109534936 13:63703746-63703768 CAATATTTCTGTTTCTAAGAGGG - Intergenic
1109587466 13:64425734-64425756 CAGAAATACTGTATCTCAGAGGG - Intergenic
1111768182 13:92561126-92561148 CACTATTACTTCACCGAAGAAGG - Intronic
1112686553 13:101835170-101835192 CACTATTACTTTATCTTCAAAGG - Intronic
1114514428 14:23288650-23288672 CGGTATTACATTACCTAAGTAGG - Intronic
1114930591 14:27462645-27462667 CAATATTAATGTATTTAAGATGG + Intergenic
1116091412 14:40311636-40311658 CAGTAATACTTCATTTAACAAGG - Intergenic
1116750236 14:48873696-48873718 CAGTGTTACCTTAACTAACATGG - Intergenic
1119964251 14:78895972-78895994 CATTATTATTATATCTGAGATGG - Intronic
1120427859 14:84373441-84373463 CAGCATTAATTTATTTACGAGGG + Intergenic
1121960890 14:98258415-98258437 CAGTATTAATTCATTTATGAGGG + Intergenic
1125430852 15:39591841-39591863 CAGTCTTACCTTCTGTAAGAAGG + Intronic
1127638896 15:60896870-60896892 CTCTATCACTTTATCTAAGTGGG + Intronic
1130760771 15:86817200-86817222 CAGAATTGCTTGATCTCAGAAGG + Intronic
1134057449 16:11179611-11179633 CAGTGTTACCATCTCTAAGAAGG + Exonic
1134207857 16:12252434-12252456 CAGTTTTCCTGTCTCTAAGATGG + Intronic
1139139566 16:64244512-64244534 CAGTAGCAGTTTATCTTAGAGGG - Intergenic
1140351226 16:74263613-74263635 TATTATTATTTTTTCTAAGATGG - Intergenic
1148098533 17:45072270-45072292 CAGTATTTTTTTATTTGAGATGG + Intronic
1148724824 17:49781124-49781146 CAGTGTTACTGTTACTAAGAAGG - Intronic
1152148307 17:78582768-78582790 CAGGATTGCTTTTTCCAAGATGG - Intergenic
1153071804 18:1115108-1115130 CTGTAATACTTTATTTAAGTTGG + Intergenic
1155782491 18:29854385-29854407 CAGTCATATTTTATTTAAGAAGG - Intergenic
1156580116 18:38365373-38365395 CCGTATTACTTTTTCTATAAAGG - Intergenic
1156779970 18:40839031-40839053 CATTTTTACTTTGCCTAAGATGG + Intergenic
1156870672 18:41941444-41941466 CTGTTTTACCTTATGTAAGAAGG - Intergenic
1157086740 18:44588134-44588156 CAGTATTTTTTTATATATGAAGG - Intergenic
1157938212 18:51896293-51896315 CAGCATTCCTTTTTCTAGGAGGG - Intergenic
1158110712 18:53938114-53938136 CTGTATTATTTTATCAAAGGTGG - Intergenic
1163670789 19:18627214-18627236 CAGATTTGCTTTATCCAAGATGG - Intergenic
1165210088 19:34228228-34228250 CATTATTTCATTATCTAAAAAGG + Exonic
925195227 2:1917677-1917699 CAGAATTTCGTTCTCTAAGAAGG - Intronic
929517787 2:42620580-42620602 CAGGATTGCTTGAGCTAAGAAGG - Intronic
930515833 2:52406802-52406824 TAGTATTAATTTATTTAAGCAGG - Intergenic
931944103 2:67285886-67285908 TATTATTACTTTATTTAAGAAGG - Intergenic
932787497 2:74620189-74620211 TTGTATTACATTATCTAGGAGGG - Intronic
936481565 2:112889773-112889795 CAGTATTAATTCATTTATGAGGG + Intergenic
936548129 2:113410674-113410696 CAGAATTAATTTATTCAAGAGGG - Intergenic
936834047 2:116685145-116685167 CAGTATTAATTTTTCCAATATGG - Intergenic
937162100 2:119773963-119773985 CAGTAATACATTATGTAAGATGG - Intronic
937617238 2:123940559-123940581 AAGTATTACATCATTTAAGAAGG + Intergenic
938046194 2:128123336-128123358 CACTCTTCTTTTATCTAAGATGG + Intronic
940749503 2:157610251-157610273 CAGCATTTGCTTATCTAAGAAGG + Intronic
941801878 2:169668819-169668841 CAATATTACTGTATCTATTATGG - Intronic
944312320 2:198247273-198247295 CAGCATGAATTCATCTAAGATGG + Intronic
945329886 2:208526932-208526954 AAGTGTTTCTTAATCTAAGATGG + Intronic
945819372 2:214645203-214645225 CAGTATAACTTTATCAGAAATGG - Intergenic
946109342 2:217400526-217400548 CAGTATTTGTTAATTTAAGAAGG - Intronic
946595351 2:221300084-221300106 CAGTCTTACTACTTCTAAGAAGG - Intergenic
948109977 2:235446830-235446852 TATTATTACTTTTTTTAAGATGG + Intergenic
1169069774 20:2717681-2717703 CAGTATTTGTTTGTATAAGATGG - Intronic
1170121413 20:12916644-12916666 CAGAATTAGATTATCTAAGGAGG + Intergenic
1179156343 21:38854208-38854230 CTGTATTACCTAATATAAGATGG + Intergenic
1180561649 22:16620043-16620065 CAGTACAACATTCTCTAAGAGGG - Intergenic
1182361586 22:29749555-29749577 CAATGCTACTTTATCCAAGATGG + Intronic
1184370481 22:44078727-44078749 GAGTATTTATTTATTTAAGATGG + Intronic
950390818 3:12695122-12695144 CAGTCTTACCTTATGTAAAATGG - Intergenic
951272420 3:20643271-20643293 CAGTATTCATATTTCTAAGAGGG + Intergenic
953483956 3:43276862-43276884 CATTATTACTTTATCTTTTATGG + Intergenic
956756932 3:72397982-72398004 CAGGAATACCTTATTTAAGAGGG - Intronic
957677725 3:83392542-83392564 CAGTCTTCTTTTTTCTAAGATGG + Intergenic
958828257 3:99058585-99058607 GAGGATTACTTGATCCAAGAAGG - Intergenic
959359624 3:105371607-105371629 CAATATTACTTGGTGTAAGATGG + Intronic
961224481 3:125228562-125228584 CAGTACTGCTTTATGTTAGAAGG - Exonic
966374489 3:179281465-179281487 AAATATGACCTTATCTAAGAGGG - Intergenic
966644739 3:182231836-182231858 CATTATTATTATATCTATGATGG - Intergenic
967098796 3:186198949-186198971 CAGTATTTTTTTTTTTAAGACGG + Intronic
969300038 4:6292287-6292309 CAGTATTTCCTTGTCCAAGAGGG - Intronic
971767493 4:30852095-30852117 CAGTATTTTCTTATGTAAGAAGG + Intronic
972026626 4:34387413-34387435 CATCATTACTTTATTTAGGAGGG - Intergenic
975258272 4:72265770-72265792 CAGAATTACATTATTTAACATGG + Intergenic
975913355 4:79295800-79295822 CTGCATTACTTTATCAATGATGG - Intronic
976777476 4:88721924-88721946 AAGGATTAATTTTTCTAAGAAGG + Intergenic
977018641 4:91730304-91730326 CAGTATTATTCTATATAGGATGG - Intergenic
977759885 4:100721013-100721035 CAGTATTATCTTATCTAAAGGGG - Intronic
982195720 4:152911131-152911153 AAGAATTACTGTATCTGAGAAGG - Exonic
983111312 4:163753657-163753679 CAGTGTTACTTTTTCTTACAGGG - Intronic
983225229 4:165080038-165080060 CATCATTGCTTTATTTAAGAAGG + Intronic
985290379 4:188380521-188380543 TAGAATTCCATTATCTAAGATGG + Intergenic
988158307 5:27484234-27484256 CAGCATTATTTTATCTAAGGTGG - Intergenic
988874284 5:35426968-35426990 GTCTATTACTTTATCAAAGATGG - Intergenic
989153255 5:38320689-38320711 CTGTCTTACATCATCTAAGAAGG - Intronic
991563045 5:67974594-67974616 AAGTATTATTTTATGTAATATGG + Intergenic
992931186 5:81647341-81647363 TAGTATTACTTTATGTACTAGGG + Intronic
993853606 5:93042531-93042553 AAGTTTTACTTTATGTAACATGG + Intergenic
995047394 5:107668659-107668681 CAGTGTTGCTTTATTTAATAAGG + Intronic
998186506 5:139983657-139983679 CAATATTCCTTTATGTCAGATGG + Intronic
998766142 5:145489358-145489380 CAGTATTACTATCACTAAAATGG - Intronic
1001477784 5:172063297-172063319 CATTATTTATTTATCTGAGACGG - Intronic
1003064928 6:2895914-2895936 CACTATTTTTTTTTCTAAGATGG - Intronic
1003125678 6:3353955-3353977 CTGCTTTACTTTCTCTAAGAAGG + Intronic
1003551578 6:7106792-7106814 CAGTATCTCTTTCTCTCAGAGGG - Intergenic
1003904043 6:10682499-10682521 CTTTATGACTTTATCAAAGAAGG - Intronic
1004742326 6:18474043-18474065 GAGGATTACTTTGTCTAAGAAGG - Intergenic
1006205325 6:32336292-32336314 CATTATGACTATTTCTAAGAGGG + Intronic
1006971190 6:38047419-38047441 CTTTATTCCTTTATCTGAGAGGG + Intronic
1008813025 6:55528216-55528238 CAGTATTACTTTCTATATGCAGG + Intronic
1011395793 6:86905475-86905497 CCTTATTACTGTGTCTAAGATGG + Intergenic
1012267222 6:97160309-97160331 CAGTTTTAATTTATTTGAGAAGG + Intronic
1012449318 6:99338502-99338524 CAGGATTATTTTATCAAAGGTGG + Intronic
1012469584 6:99556158-99556180 CAGTTTTACTGTATTTCAGAAGG + Intronic
1013235672 6:108195959-108195981 CATTATTTATTTATTTAAGATGG + Intergenic
1013343977 6:109242069-109242091 CAGTATTTCTGTTTCTGAGATGG + Intergenic
1016366921 6:143329118-143329140 CAGGATTTCTTTATCTGAGATGG + Intronic
1017275160 6:152557750-152557772 CAGTTTTTGTTTATCTAGGAAGG - Intronic
1021211171 7:17854601-17854623 CATTATTACTATATCTACTATGG + Intronic
1023063985 7:36357013-36357035 CAGTTTTTCTTTCTCTAAGTTGG + Exonic
1023380376 7:39601079-39601101 CTGTATTATTTTATGTAAGCAGG + Intronic
1023736494 7:43240331-43240353 TATTATTACTTTATTTGAGACGG - Intronic
1026510702 7:71025133-71025155 CAGTATTTGTTTATGAAAGATGG - Intergenic
1027482635 7:78718021-78718043 CACTATTTCTTTATTTAACAAGG + Intronic
1027751102 7:82148355-82148377 CAATATTCCTTTTTCTAATAGGG - Intronic
1028918186 7:96282737-96282759 AAGTATTACTTTAAATCAGATGG + Intronic
1028938076 7:96488038-96488060 AAATATTACTTTATCTAGTAAGG + Intronic
1029686479 7:102151902-102151924 CATTATTAATTTTTCTAAGGAGG - Intronic
1032567525 7:132962197-132962219 CAGTTTTTCTTTTTCTAAAATGG + Intronic
1032915959 7:136490291-136490313 CAGCATTACTTTTTCAAACAAGG + Intergenic
1033047299 7:137974280-137974302 CTGTATTCCTTTATTTCAGAGGG - Intronic
1039208502 8:35184342-35184364 CATTATTACTTTCTCATAGAGGG - Intergenic
1041562741 8:59238617-59238639 CAGAATGACTTTAGATAAGAAGG + Intergenic
1041658219 8:60375372-60375394 CCTGATTACTTTCTCTAAGAAGG + Intergenic
1043419119 8:80081083-80081105 CATGATTACTTTATCTAATGTGG + Intronic
1046400590 8:113698869-113698891 CAGAATTATTTTCTCTGAGAGGG - Intergenic
1047332626 8:123905907-123905929 CCGTATTGCTTTATGTAAGTAGG - Intronic
1050811743 9:9757046-9757068 CAGAATTATTTTATCTTAGATGG + Intronic
1051787360 9:20759899-20759921 CAGTAATACTTTATCTCAAATGG - Intronic
1052403833 9:28033953-28033975 CAATATCACCTTCTCTAAGAAGG + Intronic
1053032015 9:34788473-34788495 CAGCATTACTGTAGCTCAGAGGG - Intergenic
1053727429 9:41018114-41018136 CAGAATTAATTTATTCAAGAGGG + Intergenic
1054931204 9:70637236-70637258 CAGTATCACTTTATCTGATGGGG + Intronic
1054954725 9:70895965-70895987 AAGTATTGCTTTTTATAAGAGGG - Intronic
1055488216 9:76777768-76777790 AAGTATTATTTTATATAAGATGG + Intronic
1055662066 9:78514129-78514151 TAGTTTTACTTTATTTAAAAAGG + Intergenic
1056306169 9:85292718-85292740 CAGTATTACTGAATTTCAGAAGG - Intergenic
1058587790 9:106529152-106529174 CATTATTACTTAATTTAAAAAGG + Intergenic
1058666903 9:107327061-107327083 CATTATTACTTTATCAAAAGAGG - Intronic
1058769915 9:108220675-108220697 CAGTATTAGTTTTACTAATAAGG + Intergenic
1058844301 9:108940549-108940571 CAGTTTTACTTTGTTTCAGAGGG - Exonic
1059205689 9:112462574-112462596 CAATATTACTTTACCTGAGGAGG + Intronic
1059529149 9:115019646-115019668 CATTATCACTTTATATGAGATGG - Intronic
1059629258 9:116102344-116102366 TAATATTACTTTAACTAACATGG - Intergenic
1059953230 9:119489452-119489474 AAATATTACTTTATCCAAGAGGG - Intergenic
1186753815 X:12649065-12649087 CAGTATTACGTGACCTAACAAGG + Intronic
1187666899 X:21623274-21623296 CATTATTACTTTAGGTAAAAGGG - Intronic
1187710368 X:22047056-22047078 CAGATTTACTTTACTTAAGATGG - Exonic
1187777129 X:22773070-22773092 CAGTAATATTTTAAATAAGAGGG + Intergenic
1188142917 X:26574189-26574211 CCATCTTACTTTATCTTAGACGG - Intergenic
1189227504 X:39425348-39425370 CAGTCTTAATCTATCTAAAAGGG - Intergenic
1189617297 X:42796856-42796878 AAGTATTACTTTGGCTAAGAAGG + Intergenic
1190274036 X:48888880-48888902 AATTATTACTTTAGCAAAGAAGG + Intergenic
1193280386 X:79641763-79641785 CTGTCTTACTTTGGCTAAGAAGG + Intergenic
1194332759 X:92603699-92603721 CAATATTTGTTTATCTAGGAAGG - Intronic
1195412980 X:104589032-104589054 TAGAATTAATTTATCTATGACGG + Intronic
1198647874 X:138829306-138829328 CAGCATTACTCTATTCAAGAGGG - Intronic
1199446815 X:147933723-147933745 ATGTATTACTTTATATAAAATGG - Intronic
1200641454 Y:5722743-5722765 CAATATTTGTTTATCTAGGAAGG - Intronic