ID: 1065170004

View in Genome Browser
Species Human (GRCh38)
Location 10:23017670-23017692
Sequence CAGGAGAATCAGCTTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065170002_1065170004 -8 Left 1065170002 10:23017655-23017677 CCTGGGAGGCTGAAGCAGGAGAA 0: 176
1: 4266
2: 5649
3: 4870
4: 4804
Right 1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG No data
1065169999_1065170004 0 Left 1065169999 10:23017647-23017669 CCCAGCTACCTGGGAGGCTGAAG 0: 220
1: 8844
2: 111606
3: 218720
4: 255191
Right 1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG No data
1065170000_1065170004 -1 Left 1065170000 10:23017648-23017670 CCAGCTACCTGGGAGGCTGAAGC 0: 159
1: 6573
2: 97593
3: 206033
4: 242159
Right 1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065170004 Original CRISPR CAGGAGAATCAGCTTGAGGC TGG Intronic
No off target data available for this crispr