ID: 1065172346

View in Genome Browser
Species Human (GRCh38)
Location 10:23044031-23044053
Sequence CCAGTAGAGCATAAGGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065172346_1065172349 2 Left 1065172346 10:23044031-23044053 CCTGATGCCTTATGCTCTACTGG No data
Right 1065172349 10:23044056-23044078 ACCTTCTCTCATAGCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065172346 Original CRISPR CCAGTAGAGCATAAGGCATC AGG (reversed) Intergenic
No off target data available for this crispr