ID: 1065173672

View in Genome Browser
Species Human (GRCh38)
Location 10:23056403-23056425
Sequence TACAGTATTTTATTGTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065173672_1065173675 6 Left 1065173672 10:23056403-23056425 CCTGAGTACAATAAAATACTGTA No data
Right 1065173675 10:23056432-23056454 AAAAACAGCTTTCTTTCCCATGG No data
1065173672_1065173677 18 Left 1065173672 10:23056403-23056425 CCTGAGTACAATAAAATACTGTA No data
Right 1065173677 10:23056444-23056466 CTTTCCCATGGCTGGAGTCATGG No data
1065173672_1065173676 10 Left 1065173672 10:23056403-23056425 CCTGAGTACAATAAAATACTGTA No data
Right 1065173676 10:23056436-23056458 ACAGCTTTCTTTCCCATGGCTGG No data
1065173672_1065173681 24 Left 1065173672 10:23056403-23056425 CCTGAGTACAATAAAATACTGTA No data
Right 1065173681 10:23056450-23056472 CATGGCTGGAGTCATGGCGGAGG No data
1065173672_1065173678 21 Left 1065173672 10:23056403-23056425 CCTGAGTACAATAAAATACTGTA No data
Right 1065173678 10:23056447-23056469 TCCCATGGCTGGAGTCATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065173672 Original CRISPR TACAGTATTTTATTGTACTC AGG (reversed) Intergenic