ID: 1065173678

View in Genome Browser
Species Human (GRCh38)
Location 10:23056447-23056469
Sequence TCCCATGGCTGGAGTCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065173672_1065173678 21 Left 1065173672 10:23056403-23056425 CCTGAGTACAATAAAATACTGTA No data
Right 1065173678 10:23056447-23056469 TCCCATGGCTGGAGTCATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065173678 Original CRISPR TCCCATGGCTGGAGTCATGG CGG Intergenic