ID: 1065174671

View in Genome Browser
Species Human (GRCh38)
Location 10:23064857-23064879
Sequence TTCCACCCAATTCCAGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065174671_1065174677 -8 Left 1065174671 10:23064857-23064879 CCATTCTCTGGAATTGGGTGGAA No data
Right 1065174677 10:23064872-23064894 GGGTGGAACTTTTTTTGGGGGGG No data
1065174671_1065174679 16 Left 1065174671 10:23064857-23064879 CCATTCTCTGGAATTGGGTGGAA No data
Right 1065174679 10:23064896-23064918 AGGATCTTGCTGTGTCACACAGG No data
1065174671_1065174678 -4 Left 1065174671 10:23064857-23064879 CCATTCTCTGGAATTGGGTGGAA No data
Right 1065174678 10:23064876-23064898 GGAACTTTTTTTGGGGGGGTAGG No data
1065174671_1065174676 -9 Left 1065174671 10:23064857-23064879 CCATTCTCTGGAATTGGGTGGAA No data
Right 1065174676 10:23064871-23064893 TGGGTGGAACTTTTTTTGGGGGG No data
1065174671_1065174681 30 Left 1065174671 10:23064857-23064879 CCATTCTCTGGAATTGGGTGGAA No data
Right 1065174681 10:23064910-23064932 TCACACAGGCTGGAGTGCAGTGG 0: 1059
1: 88679
2: 177915
3: 207230
4: 178170
1065174671_1065174680 20 Left 1065174671 10:23064857-23064879 CCATTCTCTGGAATTGGGTGGAA No data
Right 1065174680 10:23064900-23064922 TCTTGCTGTGTCACACAGGCTGG 0: 30
1: 1943
2: 34848
3: 87286
4: 171524
1065174671_1065174675 -10 Left 1065174671 10:23064857-23064879 CCATTCTCTGGAATTGGGTGGAA No data
Right 1065174675 10:23064870-23064892 TTGGGTGGAACTTTTTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065174671 Original CRISPR TTCCACCCAATTCCAGAGAA TGG (reversed) Intergenic
No off target data available for this crispr