ID: 1065178420

View in Genome Browser
Species Human (GRCh38)
Location 10:23100801-23100823
Sequence ACGAGTGACTGCCTCTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065178420_1065178421 -5 Left 1065178420 10:23100801-23100823 CCATATCAGAGGCAGTCACTCGT No data
Right 1065178421 10:23100819-23100841 CTCGTTCCACTGTGACAAGATGG No data
1065178420_1065178423 2 Left 1065178420 10:23100801-23100823 CCATATCAGAGGCAGTCACTCGT No data
Right 1065178423 10:23100826-23100848 CACTGTGACAAGATGGAAAAAGG No data
1065178420_1065178424 3 Left 1065178420 10:23100801-23100823 CCATATCAGAGGCAGTCACTCGT No data
Right 1065178424 10:23100827-23100849 ACTGTGACAAGATGGAAAAAGGG No data
1065178420_1065178425 13 Left 1065178420 10:23100801-23100823 CCATATCAGAGGCAGTCACTCGT No data
Right 1065178425 10:23100837-23100859 GATGGAAAAAGGGTAGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065178420 Original CRISPR ACGAGTGACTGCCTCTGATA TGG (reversed) Intronic
No off target data available for this crispr