ID: 1065178423

View in Genome Browser
Species Human (GRCh38)
Location 10:23100826-23100848
Sequence CACTGTGACAAGATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065178419_1065178423 7 Left 1065178419 10:23100796-23100818 CCAAACCATATCAGAGGCAGTCA 0: 1
1: 0
2: 13
3: 98
4: 631
Right 1065178423 10:23100826-23100848 CACTGTGACAAGATGGAAAAAGG No data
1065178420_1065178423 2 Left 1065178420 10:23100801-23100823 CCATATCAGAGGCAGTCACTCGT No data
Right 1065178423 10:23100826-23100848 CACTGTGACAAGATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065178423 Original CRISPR CACTGTGACAAGATGGAAAA AGG Intronic
No off target data available for this crispr