ID: 1065179054

View in Genome Browser
Species Human (GRCh38)
Location 10:23106744-23106766
Sequence ATGGCCTCCACTAGGCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065179054_1065179059 2 Left 1065179054 10:23106744-23106766 CCCACAGGCCTAGTGGAGGCCAT 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1065179059 10:23106769-23106791 CTTCTCAGAGTCATTAGCCCAGG No data
1065179054_1065179060 3 Left 1065179054 10:23106744-23106766 CCCACAGGCCTAGTGGAGGCCAT 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1065179060 10:23106770-23106792 TTCTCAGAGTCATTAGCCCAGGG No data
1065179054_1065179063 24 Left 1065179054 10:23106744-23106766 CCCACAGGCCTAGTGGAGGCCAT 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1065179063 10:23106791-23106813 GGATGCGTTGCCCTCACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065179054 Original CRISPR ATGGCCTCCACTAGGCCTGT GGG (reversed) Intronic
900669566 1:3842461-3842483 CTGGTCTGCACCAGGCCTGTGGG + Intronic
900777113 1:4593686-4593708 ATGGTCTCAACTAGGCCTCGGGG + Intergenic
901517529 1:9758928-9758950 ATGGCAGCCACTAGCCATGTGGG + Intronic
902037502 1:13468264-13468286 ATGGCCTCCACCAGCCCTCTTGG - Intergenic
903188929 1:21645657-21645679 ATGGCCGCCACTATACCTCTGGG - Intronic
906120956 1:43390066-43390088 TTGGCCTCCTCTAGGTCTGGGGG + Intronic
906266152 1:44431736-44431758 ATGGCCACCACCAGGCCTGCTGG - Intronic
906310132 1:44748052-44748074 ATGGGAGACACTAGGCCTGTGGG + Intronic
907585137 1:55610427-55610449 ATGGCCTGCTCTGTGCCTGTAGG + Intergenic
908788648 1:67759227-67759249 CTGGCCTCCATTAGTACTGTGGG - Intronic
909204646 1:72739813-72739835 CTTGCCTCCTCTAGGCCTGAAGG - Intergenic
916267445 1:162904827-162904849 GTGCCCTTCCCTAGGCCTGTGGG - Intergenic
920910469 1:210211907-210211929 ATTTCTTCCACTAGGCCTGTAGG - Intergenic
921991606 1:221372951-221372973 CTGTCCTCCCCTAGGTCTGTGGG + Intergenic
922760018 1:228122770-228122792 ATGGCCTCCACGAAGTCTGTTGG + Intergenic
923262837 1:232283831-232283853 GTAGCCTCCACAATGCCTGTGGG - Intergenic
923990153 1:239427332-239427354 ATGACCTCTCCTAGGCCTGGAGG + Intronic
1064179594 10:13102599-13102621 AGGGCCTGAACTAAGCCTGTGGG + Intronic
1065179054 10:23106744-23106766 ATGGCCTCCACTAGGCCTGTGGG - Intronic
1067557692 10:47284201-47284223 ATGGCCTGGATTTGGCCTGTGGG - Intergenic
1069606151 10:69740000-69740022 AGGGTCTCCACTAGGCCAGATGG + Intergenic
1071572734 10:86706821-86706843 TTGGCTTCCTCTAGGCCTGCGGG - Intronic
1073035195 10:100559888-100559910 ATGGCCACCGCTAGTCCAGTCGG + Exonic
1075544519 10:123344771-123344793 ACGGCCTCCACTATGTTTGTAGG + Intergenic
1075663548 10:124214920-124214942 TTGGCCTCCATTAGCCCGGTTGG - Intergenic
1077718645 11:4605476-4605498 ATGGCTTCCACCAAGGCTGTGGG + Exonic
1078098442 11:8314551-8314573 CGGGCCTCCACTAGTCCTTTCGG - Intergenic
1080246673 11:30186870-30186892 ATGTCCTCCACATGGCCTCTTGG - Intergenic
1084547879 11:69823398-69823420 ATGGCATCTACAAGCCCTGTTGG - Intergenic
1089695663 11:120214863-120214885 ATGGCCTTCACTCAGCCTCTGGG - Intronic
1092231908 12:6780678-6780700 AGGGCTTCCACTAAGGCTGTGGG - Intergenic
1093503214 12:19836067-19836089 CTGTCCTCAACTAGGTCTGTAGG - Intergenic
1095664507 12:44780591-44780613 ATGGTCTTCACTAGTGCTGTGGG - Intronic
1099460137 12:82911271-82911293 CTGTCCTCCCCTAGGTCTGTTGG + Intronic
1101379893 12:104205362-104205384 CTGTCCTCATCTAGGCCTGTGGG + Intergenic
1103890727 12:124237240-124237262 ATGGCAGCCACCAGCCCTGTGGG + Intronic
1106102727 13:26708518-26708540 ATCGCCTCCTCTTGTCCTGTTGG + Intergenic
1106297375 13:28428175-28428197 GTGGCCACCAGTATGCCTGTGGG - Intronic
1112814185 13:103252465-103252487 CTGTCCTCATCTAGGCCTGTGGG + Intergenic
1113457427 13:110458418-110458440 ATTGCCACCACTGGGCCTGCGGG - Intronic
1117259802 14:54020276-54020298 ATGCCCTCCACCAGGCGTGGTGG - Intergenic
1119030558 14:71188959-71188981 ATGGACTCCATTAGACCTGCAGG + Intergenic
1122278572 14:100608173-100608195 ATGGCCTCAACTAGACCTGGAGG - Intergenic
1126164430 15:45642481-45642503 CTGGCCTGCACTTGGCCTGCAGG + Intronic
1127381388 15:58433687-58433709 ATGGCCTCCCCCAGGCTTCTGGG + Intronic
1129445161 15:75611982-75612004 AGGGCCTTCAGTAGGACTGTGGG - Intronic
1133070883 16:3246182-3246204 AAGGCCACCAGTAGGCCTGAAGG + Intronic
1133748001 16:8701979-8702001 GTGGCCTCCAGGAGGCCTGCAGG - Intronic
1135907283 16:26524586-26524608 ATGGCTTACACTTGGCCTTTTGG + Intergenic
1138416600 16:56875187-56875209 ATGGCCTCCACCCATCCTGTGGG + Intronic
1141505559 16:84475742-84475764 ATGGCCTCCAGCAAACCTGTTGG - Intergenic
1142072088 16:88096636-88096658 GCAGCCTCCACTTGGCCTGTTGG + Intronic
1143385669 17:6528939-6528961 GTGGCCTCCACAGGTCCTGTTGG - Intronic
1144134209 17:12277853-12277875 TTGGCCTCCACAAGACCTGCAGG + Intergenic
1144413069 17:15020268-15020290 ATGACCTCCTCCAGGCCTCTCGG + Intergenic
1144835908 17:18156660-18156682 ATGACCTGCCCTAGGCCTGGGGG - Intronic
1144864045 17:18323582-18323604 AGGGCCTCCCCTAGGACAGTGGG - Intergenic
1147430828 17:40369872-40369894 CTGGTCTCCTCTAGGGCTGTGGG + Intergenic
1148438938 17:47701878-47701900 GTGGCCTCCAGTAAGCCTGTGGG - Intronic
1150622919 17:66821943-66821965 TTGGCCTCCAAAAGTCCTGTGGG + Intergenic
1151627505 17:75286391-75286413 ATGGCATCCTCCAGGCCTCTAGG - Exonic
1152592717 17:81221846-81221868 GTGGCCTCCAGTAGGCCAGCAGG + Intronic
1158122056 18:54059264-54059286 GTGGCCTCCACCAGGCTTCTTGG + Intergenic
1159601701 18:70434033-70434055 ATGGCCTCTTATATGCCTGTGGG - Intergenic
1161701821 19:5800038-5800060 ATGGGACCCACAAGGCCTGTGGG - Intergenic
1163099268 19:15083789-15083811 TTCGCCTCTACTAAGCCTGTTGG - Intergenic
1164735451 19:30537543-30537565 AGGGGCTCCACTAACCCTGTCGG + Intronic
1164922959 19:32103290-32103312 ATGGCCTGCTCTAGGCCTGAAGG + Intergenic
925774562 2:7321944-7321966 ATGGCCTCCAAGAGGCTGGTGGG - Intergenic
927554375 2:24021991-24022013 ATGGCCAGCACCAAGCCTGTCGG - Intronic
929449172 2:42025301-42025323 TTGGCCTCCTCTAGCCCTGGAGG + Intergenic
932431663 2:71679248-71679270 ATGCCCTCCACTGGGGCTGGAGG - Intronic
932801486 2:74746060-74746082 ACGGCCTCCACTAGCCCAGGTGG - Intergenic
934134726 2:88984454-88984476 ATGGCCCCAACCAGGCCTTTGGG - Intergenic
934145461 2:89089054-89089076 ATGGCCCCAACCAGGCCTTTGGG - Intergenic
934223797 2:90111490-90111512 ATGGCCCCAACCAGGCCTTTGGG + Intergenic
936737553 2:115464758-115464780 ATGGCCTCCCCTTGGCCTTATGG + Intronic
937685083 2:124686969-124686991 ATGGCAGCCACTAGCCCTGTGGG + Intronic
939820699 2:146953747-146953769 ATGGCCTCCTGTCAGCCTGTGGG - Intergenic
942885622 2:180919826-180919848 ATGGCCTCTACTAGCACTTTTGG - Intergenic
944070297 2:195659895-195659917 ATGGTCTCTACTGGGCCTTTGGG + Intronic
1170243500 20:14195475-14195497 CTGTCCTCAACTAGACCTGTGGG - Intronic
1172117356 20:32581017-32581039 TTGGCCTGCTCCAGGCCTGTGGG - Intronic
1172645740 20:36468233-36468255 ATGTCCACCACTGGGTCTGTTGG + Intronic
1172760048 20:37315277-37315299 GTGGCCTGGACGAGGCCTGTGGG + Intronic
1179445378 21:41426849-41426871 ATGGCATCCACTGGGGCGGTGGG - Intronic
1180023365 21:45143432-45143454 ATGGCAGCCAGGAGGCCTGTGGG + Intronic
1182719526 22:32386258-32386280 ATGGCCTCCTCTAGGTATGGTGG + Intergenic
1183462770 22:37962359-37962381 GTTGCCTCCTCTAGTCCTGTAGG + Intronic
1183815876 22:40299748-40299770 ATGGCCCCAACTAGTCCAGTGGG + Intronic
1184105196 22:42363365-42363387 ATGGCCCCCACCCTGCCTGTTGG - Intergenic
1184976556 22:48066406-48066428 ATGGCTTCCACCAGCCCTCTGGG - Intergenic
949831251 3:8216960-8216982 AGGGCCAGCACTAGTCCTGTTGG + Intergenic
952669584 3:35949921-35949943 CTGGCTTCTACTTGGCCTGTGGG - Intergenic
954051126 3:47978601-47978623 ATGGCCTCCGCTGGGCATGGTGG - Intronic
969130672 4:4989072-4989094 ATCGCCTCCACTCTCCCTGTTGG + Intergenic
969566257 4:7980176-7980198 ATGGCCTGAACTAGGTTTGTAGG - Intronic
971221592 4:24712610-24712632 ATGGCCTCCACTAATACTGCAGG + Intergenic
972459511 4:39287763-39287785 ATGGCTTCCACAAACCCTGTTGG - Exonic
973286828 4:48427687-48427709 ATGGATTCCACTAGGCATCTTGG + Intergenic
973873344 4:55188605-55188627 ATGGCCTCCACTGACCCTGTTGG - Intergenic
974047616 4:56909792-56909814 ATGGCTTCCACTAGGCAAGTAGG + Intronic
977587538 4:98790651-98790673 ATGGCCTCCACTGGGATGGTTGG - Intergenic
978971677 4:114815249-114815271 GTTGCCTCCACTAGTTCTGTGGG - Intergenic
986344525 5:6822617-6822639 ATGGCCTCCATTATGCTTTTTGG + Intergenic
986823876 5:11499353-11499375 TTGGCTGCCACTAAGCCTGTAGG - Intronic
993330246 5:86590858-86590880 ATAGCCTCCTCAAGGCCTGCAGG + Intergenic
999045586 5:148465595-148465617 ACGGCCTTCACAAGCCCTGTGGG - Intronic
1000242059 5:159417846-159417868 ATGGCCTGCATTTGGCCTGTAGG + Intergenic
1001654553 5:173339638-173339660 CTGGCCTCCACTAGTCCCGCTGG - Intergenic
1001744379 5:174079828-174079850 ATGGACTCCACAAGGCATGAGGG + Intronic
1003204983 6:4000325-4000347 ATAGCCTCCAGTAGGATTGTGGG + Intergenic
1006405823 6:33844202-33844224 ATGACCACCCCTAGGCCTGAAGG - Intergenic
1006521155 6:34572043-34572065 ATGGTCTCTACTAGGCCAGGGGG - Intergenic
1011639548 6:89406297-89406319 CTGACCTCACCTAGGCCTGTGGG - Intronic
1012860322 6:104551598-104551620 TTGGCCTCCACTGGGACAGTGGG - Intergenic
1019052616 6:169194769-169194791 ATGGCCTGCCCTAGGGCTGAGGG - Intergenic
1023889602 7:44382760-44382782 CTGCTCTCCACTGGGCCTGTTGG - Exonic
1026110116 7:67452212-67452234 CTGGCCTCAACTTGTCCTGTGGG - Intergenic
1030116949 7:106069208-106069230 CTGGGCTCCCCTAGGCCTCTGGG + Intergenic
1030286012 7:107827470-107827492 TTGGCCTTCACTGGGCCTGAGGG + Intergenic
1033544704 7:142389368-142389390 CCAGCCTCCACTGGGCCTGTGGG - Intergenic
1034498960 7:151438000-151438022 ATGGGCTCCTGTCGGCCTGTAGG - Exonic
1035568612 8:658312-658334 CTGGCCTCCACTGGGCCTCCCGG + Intronic
1036201392 8:6773956-6773978 AAGGCCTCAACCAGGCCTGGGGG + Intergenic
1037607865 8:20452696-20452718 ATGGCCCCCTCCAGGCCTGCAGG - Intergenic
1042116936 8:65442558-65442580 ATGGACTCAACCAGGCCTGGGGG - Intergenic
1045256457 8:100528132-100528154 AGGGCCTACCCTAGGGCTGTGGG + Intronic
1049451381 8:142663938-142663960 ATGGCCTCCTGTCGGCCTGGAGG + Intronic
1050784880 9:9388309-9388331 CTGTCCTCAACTAGGTCTGTGGG + Intronic
1054803846 9:69379416-69379438 GTGGCCTGGGCTAGGCCTGTGGG + Intronic
1055243831 9:74217380-74217402 CTGGCCTCACCTAGGTCTGTGGG - Intergenic
1058841212 9:108911379-108911401 ATGGACTCCCCTAGGCCTAGAGG - Intronic
1061986838 9:134135146-134135168 ATCCCCTCAGCTAGGCCTGTGGG - Intergenic
1062227009 9:135457924-135457946 ATGGCCTCCACTGTGCCTGTAGG + Intergenic
1185599861 X:1331394-1331416 ATGGCCCCCACCAGGCATGGTGG + Intergenic
1185599933 X:1331898-1331920 ATGGCCCCCACCAGGCATGGTGG + Intergenic
1186753926 X:12650004-12650026 ATGGACACCAGTAGGCCTGGAGG + Intronic
1187253289 X:17619227-17619249 GTGACATACACTAGGCCTGTTGG + Intronic
1189331082 X:40145533-40145555 GTGACCTCCACTAAGCCTGGAGG + Intronic
1192005170 X:67203991-67204013 ATGGCCTCCACTTGTACTGCAGG + Intergenic
1195671324 X:107472647-107472669 ATGGGCTCCCTTGGGCCTGTTGG + Intergenic
1198933179 X:141880905-141880927 ATGGCATCCAACAGGCCTGAGGG - Intronic
1200058650 X:153474407-153474429 ATCGCCTCCAGTGGGCCTGGAGG + Intronic