ID: 1065179055

View in Genome Browser
Species Human (GRCh38)
Location 10:23106745-23106767
Sequence CATGGCCTCCACTAGGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065179055_1065179059 1 Left 1065179055 10:23106745-23106767 CCACAGGCCTAGTGGAGGCCATG 0: 1
1: 0
2: 2
3: 17
4: 187
Right 1065179059 10:23106769-23106791 CTTCTCAGAGTCATTAGCCCAGG No data
1065179055_1065179060 2 Left 1065179055 10:23106745-23106767 CCACAGGCCTAGTGGAGGCCATG 0: 1
1: 0
2: 2
3: 17
4: 187
Right 1065179060 10:23106770-23106792 TTCTCAGAGTCATTAGCCCAGGG No data
1065179055_1065179063 23 Left 1065179055 10:23106745-23106767 CCACAGGCCTAGTGGAGGCCATG 0: 1
1: 0
2: 2
3: 17
4: 187
Right 1065179063 10:23106791-23106813 GGATGCGTTGCCCTCACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065179055 Original CRISPR CATGGCCTCCACTAGGCCTG TGG (reversed) Intronic
900389685 1:2428549-2428571 CGTGGCCTCGCCTAGGCTTGCGG + Intronic
900599276 1:3496188-3496210 CCTGGCCCCCAGCAGGCCTGCGG - Intronic
900777112 1:4593685-4593707 CATGGTCTCAACTAGGCCTCGGG + Intergenic
901517528 1:9758927-9758949 CATGGCAGCCACTAGCCATGTGG + Intronic
902828194 1:18991899-18991921 GATGGCCCCCTCTAGGTCTGGGG - Intergenic
903188930 1:21645658-21645680 CATGGCCGCCACTATACCTCTGG - Intronic
906063797 1:42965551-42965573 AATGACCTCCTCTAGGGCTGGGG + Intergenic
906097564 1:43234654-43234676 CTTGGCCTCCACAGGGGCTGAGG - Intronic
906120955 1:43390065-43390087 GTTGGCCTCCTCTAGGTCTGGGG + Intronic
907242874 1:53090405-53090427 CCTGGCCTCCGCTCGCCCTGTGG + Intronic
907275163 1:53313000-53313022 CTTGCCCTCCACTGGGCCTCTGG - Intronic
913088059 1:115457392-115457414 CATGGCCTCCACCTTCCCTGAGG + Intergenic
916056291 1:161070840-161070862 ATTGGCCTCCACAAGGCCTTTGG - Intergenic
916250446 1:162732718-162732740 CATGGCCCACATGAGGCCTGAGG - Intronic
916375421 1:164148396-164148418 CATTGGGTCTACTAGGCCTGTGG + Intergenic
916469876 1:165112693-165112715 CATGGTCTCCACTTGGCCTTTGG + Intergenic
918961440 1:191283045-191283067 CATGGCCTCCCAAGGGCCTGGGG + Intergenic
919790667 1:201288794-201288816 CATGGCCACCACCAAGCCTGAGG - Intronic
920730121 1:208475488-208475510 CATGGCTTCCACTGTGCTTGGGG - Intergenic
921991605 1:221372950-221372972 CCTGTCCTCCCCTAGGTCTGTGG + Intergenic
1065179055 10:23106745-23106767 CATGGCCTCCACTAGGCCTGTGG - Intronic
1065482570 10:26210508-26210530 AGTGGCTTACACTAGGCCTGTGG - Intronic
1067473118 10:46550131-46550153 CAGTGCCACCACTAGACCTGGGG - Exonic
1070764605 10:79049103-79049125 CATGGCCCCCTCCAGGACTGAGG + Intergenic
1071572735 10:86706822-86706844 CTTGGCTTCCTCTAGGCCTGCGG - Intronic
1071832156 10:89382547-89382569 CCTGTCCTCCACTAGGCTTCAGG + Intronic
1071885371 10:89943907-89943929 CATGGACTCTCCTAGGCATGGGG + Intergenic
1072766836 10:98101498-98101520 CATAGCTTCCACTAGAGCTGGGG - Intergenic
1073444200 10:103571163-103571185 CATGGCATCCCCTGGGCCTCTGG + Intronic
1076080877 10:127579241-127579263 CAAGGTCTCCAGCAGGCCTGGGG - Intergenic
1076607061 10:131695944-131695966 GGTGGCGTCCACTGGGCCTGGGG - Intergenic
1077259175 11:1606592-1606614 CGTGGCATCCACTTGGCTTGGGG - Intergenic
1077411062 11:2404147-2404169 TGTGGTCTGCACTAGGCCTGGGG - Intergenic
1078069033 11:8096287-8096309 CAAGGCCTCTAATAGGCCTGAGG + Intronic
1080430110 11:32190155-32190177 CATGGTCTCCACCAGCACTGTGG - Intergenic
1080515991 11:33020752-33020774 CATGGCCTCCCAAAGTCCTGGGG + Intronic
1080612482 11:33916520-33916542 CATGGCCTTCCCTTGGCCCGAGG + Intergenic
1080991600 11:37543875-37543897 CAAGGCCACAACTAGGACTGTGG + Intergenic
1081952448 11:47056116-47056138 CAAGGCCTACATTAGTCCTGTGG + Intronic
1083589997 11:63888316-63888338 CAAAGCCTCCAATAGGGCTGGGG - Intronic
1084267964 11:68014636-68014658 CAGGGCCTCCAGGAGGCCCGAGG + Intronic
1084446254 11:69205265-69205287 CATGACCACCACGAGGCCTCAGG - Intergenic
1084735488 11:71102777-71102799 CCTGGGCTCCACTTGCCCTGGGG - Intronic
1088249405 11:107849850-107849872 CATGCCCTCCACTGGGCCTCTGG - Intronic
1089493914 11:118899179-118899201 CATGGCCCCCACTGGGGGTGGGG - Exonic
1089730229 11:120514592-120514614 CAAAGACTCCACCAGGCCTGGGG - Intronic
1090838080 11:130468025-130468047 CATGGCCACCCCCAGCCCTGCGG - Intronic
1091538084 12:1432431-1432453 CTTGGCCTCACCAAGGCCTGTGG - Intronic
1091798056 12:3308562-3308584 CCTGGCCACCTCTAGGCTTGGGG + Intergenic
1091799220 12:3314172-3314194 CATGGCCTCCATAAAGCCTTGGG + Intergenic
1091896552 12:4109819-4109841 CCTGGCCTTCCCAAGGCCTGTGG - Intergenic
1092231909 12:6780679-6780701 CAGGGCTTCCACTAAGGCTGTGG - Intergenic
1096522206 12:52190891-52190913 CATGGCCTGCAACAGGTCTGGGG - Intronic
1100391684 12:94149858-94149880 CAGGGCCTCCACTAGGCTGGAGG - Exonic
1101379892 12:104205361-104205383 CCTGTCCTCATCTAGGCCTGTGG + Intergenic
1101718012 12:107328043-107328065 CATGGCCTCCACTAGATGTAAGG + Intronic
1103932125 12:124456406-124456428 CAGGGACTCCAGGAGGCCTGGGG + Intronic
1104089017 12:125499042-125499064 CAAGGCCTCTACTAGGCCTTTGG + Intronic
1109114275 13:58361139-58361161 CCTGGCATCAACTAGGTCTGAGG - Intergenic
1112814184 13:103252464-103252486 CCTGTCCTCATCTAGGCCTGTGG + Intergenic
1113457428 13:110458419-110458441 GATTGCCACCACTGGGCCTGCGG - Intronic
1121779105 14:96610443-96610465 CAGGGTCTTCACTGGGCCTGGGG + Intergenic
1122014114 14:98779052-98779074 GATGGCCTGCACTAGGACAGAGG - Intergenic
1122919403 14:104873900-104873922 CATGGGCTCCACGGGGCCAGGGG - Intronic
1123450451 15:20356666-20356688 CCTGGGCTCCCCCAGGCCTGGGG - Intergenic
1124930058 15:34110976-34110998 CTTGTCATCCACTAGGACTGTGG + Intergenic
1125577891 15:40767585-40767607 CATGGCCTACACAAGGCCCTCGG - Exonic
1128239197 15:66089457-66089479 CCTGCCCTCCAGAAGGCCTGGGG - Intronic
1128913268 15:71536213-71536235 TAAAGCCTCCACAAGGCCTGCGG - Intronic
1128983566 15:72203093-72203115 CATGGCTTCCATGAGGTCTGTGG + Exonic
1129467190 15:75730820-75730842 CCTGGCCTCCAGGAGGTCTGAGG + Intergenic
1129720038 15:77872899-77872921 CCTGGCCTCCAGGAGGTCTGAGG - Intergenic
1130228814 15:82080958-82080980 CTTGGCCTCCCCTAGTACTGGGG - Intergenic
1130265695 15:82400774-82400796 CATGGCCTCCCATAGTGCTGGGG - Intergenic
1130506318 15:84546141-84546163 CATGGCCTCCCATAGTGCTGGGG + Intergenic
1136598127 16:31265805-31265827 CACGGCCTCCACGGGGACTGCGG - Exonic
1138449905 16:57087540-57087562 CATGGCCAAAGCTAGGCCTGAGG + Intergenic
1142276912 16:89123601-89123623 AATGGCCATCCCTAGGCCTGTGG + Intronic
1143515080 17:7415453-7415475 ACTGGCCTCCTCTTGGCCTGTGG - Intronic
1144735834 17:17554986-17555008 CACGGCCTCCACTGGGGATGCGG + Intronic
1144835909 17:18156661-18156683 GATGACCTGCCCTAGGCCTGGGG - Intronic
1144864046 17:18323583-18323605 CAGGGCCTCCCCTAGGACAGTGG - Intergenic
1145000569 17:19301869-19301891 CAGGGCCTCCTCTAGGCCTGAGG - Intronic
1145788194 17:27607840-27607862 CATGGGCTCCACCAGGGTTGGGG + Intronic
1148438939 17:47701879-47701901 GGTGGCCTCCAGTAAGCCTGTGG - Intronic
1149681257 17:58508857-58508879 CTTTGCCTCACCTAGGCCTGTGG - Intronic
1150622918 17:66821942-66821964 CTTGGCCTCCAAAAGTCCTGTGG + Intergenic
1152337991 17:79708671-79708693 CCTGGGCTCCCCCAGGCCTGGGG + Intergenic
1152368590 17:79871283-79871305 CAAGGCCTGCACCAGGCCCGAGG - Intergenic
1156389594 18:36638251-36638273 CATGGCATGCCCTTGGCCTGGGG - Intronic
1156842939 18:41630692-41630714 CATGGCCTACTGAAGGCCTGAGG - Intergenic
1157696662 18:49728677-49728699 AATGGCCTCCACTGGGCCTTTGG + Intergenic
1159037255 18:63289640-63289662 CTTGGCCTCCTCGAGGGCTGGGG - Intronic
1159601702 18:70434034-70434056 CATGGCCTCTTATATGCCTGTGG - Intergenic
1160108679 18:76004632-76004654 CATGGCCTCCATGAGGACAGAGG + Intergenic
1160581964 18:79888159-79888181 CATGGCCTCCTCCACCCCTGAGG - Intronic
1163695470 19:18761348-18761370 CGTGGCCCCAACTAGTCCTGGGG + Intronic
1164611456 19:29635232-29635254 CCTGGCCTCCACTGGGCCCTAGG - Intergenic
1164770220 19:30802445-30802467 CAAGGCCTGCGCTAGGTCTGGGG + Intergenic
1165244347 19:34489590-34489612 CATGGCCTGCTCTTGGACTGAGG - Intronic
1166865133 19:45831411-45831433 TCTGGCCTCCTCTTGGCCTGCGG + Exonic
926132932 2:10316491-10316513 CATGGCCCTCACAAGGGCTGAGG - Intronic
926163107 2:10501876-10501898 CCTTCCCTCCACTGGGCCTGTGG + Intergenic
929782464 2:44965924-44965946 CAGGGCCCCCAAAAGGCCTGTGG + Intergenic
930357003 2:50333693-50333715 GACGGCCTCTATTAGGCCTGAGG + Intronic
932912718 2:75821680-75821702 TATGGCCTCTACTAGGGCTATGG - Intergenic
937685082 2:124686968-124686990 TATGGCAGCCACTAGCCCTGTGG + Intronic
939820700 2:146953748-146953770 CATGGCCTCCTGTCAGCCTGTGG - Intergenic
942052732 2:172155793-172155815 CTTGGAGTCCACTAGACCTGGGG + Intergenic
946230080 2:218285898-218285920 CAAGGCCTCCACTAGGGATGAGG + Exonic
946327831 2:218993746-218993768 CCTGGCCTCCCCTGGGCCTCGGG + Intergenic
947366238 2:229397504-229397526 CATGCTCTCCACTCGGCCTTTGG - Intronic
1170243501 20:14195476-14195498 CCTGTCCTCAACTAGACCTGTGG - Intronic
1173735223 20:45356479-45356501 CATGGCCTCCCAGAGGGCTGGGG - Intergenic
1179445379 21:41426850-41426872 CATGGCATCCACTGGGGCGGTGG - Intronic
1180023364 21:45143431-45143453 CATGGCAGCCAGGAGGCCTGTGG + Intronic
1180071157 21:45436544-45436566 TGTGGCCTCCACGTGGCCTGAGG - Intronic
1181747726 22:24967530-24967552 CAAGGCCTGCACTGGGCCTTGGG + Intronic
1182061646 22:27402683-27402705 CTGGACCTCCACTTGGCCTGTGG - Intergenic
1182151495 22:28030185-28030207 CCTGCCCTGCACTGGGCCTGGGG + Intronic
1182257339 22:29048731-29048753 TCTGGCCTCTCCTAGGCCTGAGG + Intronic
1183464608 22:37973403-37973425 CACTGCCACCACCAGGCCTGAGG + Exonic
1183815875 22:40299747-40299769 CATGGCCCCAACTAGTCCAGTGG + Intronic
1184297394 22:43533597-43533619 CAAGGCCTCTACTAGGCTTTGGG - Intronic
1184427754 22:44423211-44423233 CAGGCCCTGCACCAGGCCTGGGG - Intergenic
1185047192 22:48534428-48534450 CATGGCCAGCTCTAGGACTGAGG + Intronic
1185392693 22:50571176-50571198 CATGGCCTGCACAAAGGCTGTGG + Exonic
949954506 3:9256580-9256602 CATGGCTTCCACTGGGTTTGAGG + Intronic
950007742 3:9702253-9702275 CATGGCTTCCACAAGGCCCCAGG - Exonic
950412375 3:12847509-12847531 CTTGGCCACCACTAGCCCAGAGG + Intronic
950553473 3:13681538-13681560 CACAGTCTCCACAAGGCCTGGGG - Intergenic
953666943 3:44932145-44932167 CATGCCTTCTGCTAGGCCTGGGG - Intronic
953884634 3:46708376-46708398 CATCCCCTCCTCTAGGGCTGGGG + Intronic
954333538 3:49903436-49903458 CATGGCCTGTACCAGGCCTCCGG + Exonic
956262861 3:67364133-67364155 CATGGGCTTCAGTAGGGCTGGGG - Intronic
958949458 3:100400928-100400950 CATGGCCGCCTCTAAACCTGTGG - Exonic
960877549 3:122312270-122312292 CATGGCCTGAATTAAGCCTGAGG - Intergenic
961820166 3:129571807-129571829 CATCGCCTGCACCATGCCTGAGG - Exonic
962269302 3:133966483-133966505 CCTGGCCTCTTCTTGGCCTGGGG - Intronic
963672272 3:148266923-148266945 CCTGACCTCCACTATGCCAGAGG - Intergenic
967774987 3:193376833-193376855 CACAGACTCCGCTAGGCCTGAGG - Intronic
967959878 3:194911983-194912005 AATGGCAACCACTAGGACTGTGG + Intergenic
969311856 4:6357560-6357582 CATCGCCTCCTGTAGGCCTGGGG - Intronic
969339892 4:6533530-6533552 CATGGCCGGCACTGGGCCTAAGG + Intronic
973714500 4:53662016-53662038 CAGGGCCTCCAGGGGGCCTGGGG - Intronic
976782362 4:88775241-88775263 CTTGGCCTCCTCAAGGCCTTGGG - Intronic
979403722 4:120283073-120283095 CATGCCCACCTCTAGGCCTGGGG + Intergenic
980306395 4:131065637-131065659 CCTGGCCTCCACTAGCTCCGTGG + Intergenic
984091304 4:175378612-175378634 CATGGTCTCCACTAACACTGAGG - Intergenic
986909060 5:12532247-12532269 CATGGCCTCCATGAAGGCTGGGG - Intergenic
989488427 5:42020752-42020774 TATGGCCTCCACTAGCCATAAGG + Intergenic
989777454 5:45226029-45226051 CATGGGCTCCACTAGGCAAAGGG + Intergenic
991433089 5:66568538-66568560 GATGCCCTCCACCAGTCCTGTGG + Intergenic
993146023 5:84095187-84095209 CATGACCTGCACTAGGCCTGTGG + Intronic
997966513 5:138361113-138361135 CTTTGCTTCCACAAGGCCTGGGG + Intronic
999045587 5:148465596-148465618 CACGGCCTTCACAAGCCCTGTGG - Intronic
1001305452 5:170569121-170569143 CATGGCCTCCAGGGGTCCTGGGG + Intronic
1001433987 5:171685473-171685495 CCTGACCTCCACTGTGCCTGGGG - Intergenic
1001744378 5:174079827-174079849 CATGGACTCCACAAGGCATGAGG + Intronic
1001953623 5:175833212-175833234 CATGGCCTCCACAAAGCTTTGGG + Intronic
1003146286 6:3513084-3513106 CATGGCCTGCCCGAGGCCTCAGG - Intergenic
1003204982 6:4000324-4000346 CATAGCCTCCAGTAGGATTGTGG + Intergenic
1003218451 6:4135854-4135876 CGTGGCCTCCTCTGGGGCTGCGG + Intergenic
1004759470 6:18650023-18650045 CATGACCCCCATTAGGCATGAGG - Intergenic
1006070573 6:31495156-31495178 CTTGGCCTCCCCTAGCCCAGGGG + Intronic
1006521156 6:34572044-34572066 CATGGTCTCTACTAGGCCAGGGG - Intergenic
1006931929 6:37693904-37693926 CATGGTCTGCAATAGGGCTGGGG - Intronic
1011349287 6:86404712-86404734 CATGGCCTCCATTTACCCTGGGG - Intergenic
1011639549 6:89406298-89406320 CCTGACCTCACCTAGGCCTGTGG - Intronic
1012860323 6:104551599-104551621 CTTGGCCTCCACTGGGACAGTGG - Intergenic
1019052617 6:169194770-169194792 GATGGCCTGCCCTAGGGCTGAGG - Intergenic
1023382026 7:39618269-39618291 CATGGCATTCACTTTGCCTGGGG - Intergenic
1025730256 7:64101851-64101873 CAGGACTTGCACTAGGCCTGGGG + Intronic
1027516913 7:79153674-79153696 CATGGCTTCCACTATGCTTAGGG - Intronic
1029133893 7:98354842-98354864 CAAGGCCTCCACTCGCCCTCCGG + Intronic
1030286011 7:107827469-107827491 CTTGGCCTTCACTGGGCCTGAGG + Intergenic
1032236810 7:130131726-130131748 CTTGGCTTCCACTCGGGCTGTGG + Exonic
1032698605 7:134359207-134359229 CAAGGCCTCCACTAAGGGTGGGG + Intergenic
1034432659 7:151048896-151048918 CCGGGCCTCCTCTGGGCCTGAGG - Exonic
1036201391 8:6773955-6773977 CAAGGCCTCAACCAGGCCTGGGG + Intergenic
1038528701 8:28298805-28298827 CAGGACCTCCACTGGGGCTGAGG - Intergenic
1039701045 8:39962171-39962193 TATGGCCCACTCTAGGCCTGTGG - Intronic
1042116937 8:65442559-65442581 CATGGACTCAACCAGGCCTGGGG - Intergenic
1044971544 8:97624922-97624944 CCTTGCCTCCACTAGCTCTGCGG + Intergenic
1049413428 8:142484108-142484130 CCTGGTCTCCAGTCGGCCTGGGG + Intronic
1050784879 9:9388308-9388330 CCTGTCCTCAACTAGGTCTGTGG + Intronic
1051368426 9:16337820-16337842 AAGGGCCTGAACTAGGCCTGGGG + Intergenic
1052194571 9:25695841-25695863 CATGGCCTCTAGCAGGACTGAGG + Intergenic
1052787662 9:32844588-32844610 CATGTCCTCCTCTAGTCTTGGGG + Intergenic
1053616020 9:39766694-39766716 CAAGCCCTCCTCTAGCCCTGAGG + Intergenic
1053874193 9:42526004-42526026 CAAGCCCTCCTCTAGCCCTGAGG + Intergenic
1053898427 9:42768581-42768603 CAAGCCCTCCTCTAGCCCTGAGG - Intergenic
1054237497 9:62575696-62575718 CAAGCCCTCCTCTAGCCCTGAGG - Intergenic
1054268140 9:62940750-62940772 CAAGCCCTCCTCTAGCCCTGAGG - Intergenic
1054551633 9:66610207-66610229 CAAGCCCTCCTCTAGCCCTGAGG - Intergenic
1055243832 9:74217381-74217403 CCTGGCCTCACCTAGGTCTGTGG - Intergenic
1056388101 9:86116113-86116135 CAAGGCCTCCTCAGGGCCTGCGG + Intergenic
1057190499 9:93084436-93084458 CAGGCCCTCCAGTGGGCCTGGGG - Intronic
1059514470 9:114880152-114880174 GTTGGCCTTCATTAGGCCTGGGG + Intergenic
1059820161 9:117963701-117963723 CATGGCAGCCTCTAGGGCTGTGG + Intergenic
1062311369 9:135939382-135939404 CACGGCCTCCACCACGCCCGGGG + Intronic
1062665258 9:137667389-137667411 CCTGACCTCCACATGGCCTGGGG - Intronic
1187049688 X:15683602-15683624 CATGGCCTCCCAAAGGGCTGGGG - Intergenic
1189336141 X:40171998-40172020 CCTGGCCCCCTCTGGGCCTGGGG + Intronic
1191061142 X:56297808-56297830 CATATCCTCCACCAGCCCTGTGG - Intergenic
1195497868 X:105559012-105559034 CATTGCCTCCTCTAAGCCTAGGG + Intronic
1198933180 X:141880906-141880928 GATGGCATCCAACAGGCCTGAGG - Intronic