ID: 1065179057

View in Genome Browser
Species Human (GRCh38)
Location 10:23106752-23106774
Sequence GAGAAGCCATGGCCTCCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065179057_1065179063 16 Left 1065179057 10:23106752-23106774 CCTAGTGGAGGCCATGGCTTCTC No data
Right 1065179063 10:23106791-23106813 GGATGCGTTGCCCTCACTTGTGG No data
1065179057_1065179059 -6 Left 1065179057 10:23106752-23106774 CCTAGTGGAGGCCATGGCTTCTC No data
Right 1065179059 10:23106769-23106791 CTTCTCAGAGTCATTAGCCCAGG No data
1065179057_1065179066 27 Left 1065179057 10:23106752-23106774 CCTAGTGGAGGCCATGGCTTCTC No data
Right 1065179066 10:23106802-23106824 CCTCACTTGTGGATTTCCATTGG No data
1065179057_1065179060 -5 Left 1065179057 10:23106752-23106774 CCTAGTGGAGGCCATGGCTTCTC No data
Right 1065179060 10:23106770-23106792 TTCTCAGAGTCATTAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065179057 Original CRISPR GAGAAGCCATGGCCTCCACT AGG (reversed) Intronic
No off target data available for this crispr