ID: 1065179058

View in Genome Browser
Species Human (GRCh38)
Location 10:23106763-23106785
Sequence CTAATGACTCTGAGAAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065179058_1065179063 5 Left 1065179058 10:23106763-23106785 CCATGGCTTCTCAGAGTCATTAG 0: 1
1: 0
2: 2
3: 20
4: 303
Right 1065179063 10:23106791-23106813 GGATGCGTTGCCCTCACTTGTGG No data
1065179058_1065179066 16 Left 1065179058 10:23106763-23106785 CCATGGCTTCTCAGAGTCATTAG 0: 1
1: 0
2: 2
3: 20
4: 303
Right 1065179066 10:23106802-23106824 CCTCACTTGTGGATTTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065179058 Original CRISPR CTAATGACTCTGAGAAGCCA TGG (reversed) Intronic
900690926 1:3979896-3979918 CTGATCACTCTGAGACTCCAAGG - Intergenic
901618818 1:10564682-10564704 CTCAGGACTTTGAGAGGCCAAGG - Intronic
902180757 1:14686713-14686735 CAGAGGTCTCTGAGAAGCCAGGG - Intronic
902232760 1:15037999-15038021 CCCAGCACTCTGAGAAGCCAAGG + Intronic
902252281 1:15161957-15161979 CTGATGCATCTGAGATGCCATGG - Intronic
904119999 1:28191813-28191835 CCCAGCACTCTGAGAAGCCAAGG + Intronic
904558120 1:31378811-31378833 CCAAGGACTCTGAGAAGCTAGGG + Intergenic
904692249 1:32302252-32302274 CTAATAATTCTGAGTAGCGATGG + Intronic
906444819 1:45887076-45887098 CTAAGCACTTTGGGAAGCCAAGG - Intronic
906680645 1:47723525-47723547 CTCAAGATTCTGAGGAGCCAGGG - Intergenic
907627397 1:56043553-56043575 CACATGACTCTGAGGAGGCATGG - Intergenic
908025756 1:59950122-59950144 CTAAAGACTCTAAGAAGCCATGG + Intergenic
908627716 1:66064280-66064302 CTAATGACAGTGGGAAGCCTAGG + Intronic
909834526 1:80237089-80237111 TTAAGGACTCTGAAAAGGCAAGG + Intergenic
909866404 1:80678084-80678106 TTGATGACCCTGAGAAGCCAAGG - Intergenic
913128894 1:115819289-115819311 CCAATCACTATGAGAAGGCATGG + Intergenic
915397528 1:155597021-155597043 CTTATGAGCCTGGGAAGCCAAGG + Intergenic
916306054 1:163334523-163334545 CTTATCACTTTGAGAGGCCAAGG + Intronic
916537440 1:165716961-165716983 CTCAGCACTTTGAGAAGCCAAGG - Intergenic
917721220 1:177788224-177788246 CTGATGACGCTGAGAAGCTTGGG - Intergenic
917860726 1:179140781-179140803 CTCAGCACTTTGAGAAGCCAAGG + Intronic
918051803 1:180979954-180979976 CTCAGCACTTTGAGAAGCCATGG + Intronic
918396008 1:184113802-184113824 CAAATGACATTGAGAAGTCAAGG - Intergenic
918598847 1:186328032-186328054 CTGAGTACTCTGAGAGGCCAAGG - Intronic
918657810 1:187050650-187050672 CTGATGAATTTGACAAGCCATGG + Intergenic
918732033 1:188011055-188011077 CCCATTACTCTGGGAAGCCAAGG - Intergenic
921127391 1:212189715-212189737 CCTATCACTCTGGGAAGCCAAGG + Intergenic
921259652 1:213374618-213374640 GCAATGACTTTGAGAAGCAAGGG + Intergenic
921389118 1:214601871-214601893 ATAATTACTCTGGGAAGCAATGG + Intergenic
921724732 1:218511279-218511301 CTCATTACTCTGATAAACCATGG + Intergenic
921725205 1:218515719-218515741 GTTATGCCTCTGAGAAGGCAGGG + Intergenic
922075538 1:222240060-222240082 AAAATGACTGTGAGAAGCCTGGG - Intergenic
922187341 1:223287189-223287211 CCAGCTACTCTGAGAAGCCAAGG - Intronic
922391619 1:225149398-225149420 AAAATGAGTCTGAAAAGCCAAGG - Intronic
922433337 1:225578212-225578234 CCCAGCACTCTGAGAAGCCAAGG + Intronic
922902178 1:229145823-229145845 CTAATCACTGAGACAAGCCAGGG + Intergenic
924282235 1:242450052-242450074 TTAAAGCATCTGAGAAGCCATGG - Intronic
1063263322 10:4415357-4415379 CTAAACACTTTGAGAGGCCAAGG - Intergenic
1064784356 10:18877576-18877598 CTCAGCACTCTGGGAAGCCAAGG - Intergenic
1065179058 10:23106763-23106785 CTAATGACTCTGAGAAGCCATGG - Intronic
1067266829 10:44753611-44753633 TCAATGGGTCTGAGAAGCCATGG + Intergenic
1068295633 10:55069154-55069176 GTAATCACTTTGAGAGGCCAAGG - Intronic
1069657307 10:70099514-70099536 CTCATGTCTCTGAGATGACATGG - Intronic
1070822298 10:79366332-79366354 CCCAACACTCTGAGAAGCCAAGG - Intergenic
1071572079 10:86702835-86702857 CTAAAGACACCAAGAAGCCAGGG - Intronic
1072080955 10:92031623-92031645 CTTATGCCTATGAGAGGCCAAGG + Intergenic
1072621678 10:97083926-97083948 CCAAAGACTGTGAGAAGTCAGGG - Intronic
1073332302 10:102678313-102678335 CTACTTACTCTGAGAAGCTAAGG + Intronic
1073606661 10:104902363-104902385 CCAGTGACTCTGAGAGGTCATGG + Intronic
1074563418 10:114554441-114554463 CTTAACACTTTGAGAAGCCAAGG + Intronic
1075102653 10:119517198-119517220 CAAAAGATCCTGAGAAGCCACGG + Intronic
1075141961 10:119845944-119845966 CTAATGTCTGTGAAAAACCATGG - Intronic
1075895509 10:125991186-125991208 CTAATTACTCATGGAAGCCATGG - Intronic
1076695057 10:132243358-132243380 CTAATCACACTGAGCAGCCTGGG + Intronic
1077728977 11:4707914-4707936 CTAATGAAACTGAGGAGACATGG - Intronic
1079604234 11:22344445-22344467 CTGAGGACTCTGAGAAGCCTTGG - Intronic
1081360680 11:42173785-42173807 TTAATTACTCTGAGAATGCAAGG + Intergenic
1081962738 11:47150343-47150365 CAAATGAGTGAGAGAAGCCACGG - Intronic
1085023348 11:73222479-73222501 CTAAGGACACTGAGGAGCCATGG - Intronic
1085149007 11:74232954-74232976 CCCATGACTCTGAGAGGCCGAGG - Intronic
1085186999 11:74584038-74584060 CTAATGATTCTGACAGGGCATGG - Intronic
1087294319 11:96352146-96352168 CACAGGACTTTGAGAAGCCAAGG + Intergenic
1087408929 11:97766052-97766074 CCAAACACTCGGAGAAGCCAAGG - Intergenic
1087490363 11:98818640-98818662 TCAATAACTCTGAGAAGTCAAGG + Intergenic
1088485391 11:110335472-110335494 CTCAGCACTTTGAGAAGCCAAGG + Intergenic
1091046916 11:132333240-132333262 CTGAGGACTCTGAGACGACAAGG - Intronic
1091846765 12:3662244-3662266 TGAATGACTATGAGAAGCCTCGG + Intronic
1092057837 12:5522212-5522234 CTAGGGACTCAGAGAAGTCATGG - Intergenic
1096799354 12:54099377-54099399 CTGCTGACTCTTAGAGGCCAAGG - Intergenic
1096975390 12:55696863-55696885 AAAATGACCCTCAGAAGCCAAGG + Intronic
1097288532 12:57895752-57895774 CTGGTTGCTCTGAGAAGCCATGG + Intergenic
1098492395 12:71097169-71097191 CTCAGCACTCTGGGAAGCCAAGG - Intronic
1099538815 12:83879029-83879051 GTACTAACTCTGAGAAGTCAAGG - Intergenic
1099914515 12:88875372-88875394 CTATTGATTCTGAGGAGGCAGGG - Intergenic
1100860659 12:98802713-98802735 CTAACTACAGTGAGAAGCCAAGG - Intronic
1101794322 12:107958850-107958872 CGAATCATTCAGAGAAGCCAGGG + Intergenic
1102638918 12:114349107-114349129 CCAAGGACTTTGAGAGGCCAAGG + Intergenic
1105634559 13:22204590-22204612 CAAATGACTCAGAGAAGGAAAGG + Intergenic
1106263759 13:28091682-28091704 CTCAGCACTCTGGGAAGCCAAGG + Intronic
1108765676 13:53626299-53626321 CTAAAGACTCTGAGGAGCAGGGG + Intergenic
1113287523 13:108868670-108868692 CTCAGCACTTTGAGAAGCCAAGG + Intronic
1114539251 14:23442774-23442796 CTTGTGGCTCTGAGAAGCCAGGG + Intergenic
1115773627 14:36691601-36691623 TTATTGACTTTGAGAGGCCAAGG + Intronic
1116016608 14:39415182-39415204 CCAAGCACTCTGGGAAGCCAAGG + Intronic
1116231852 14:42228640-42228662 CTTATCACTCTGACCAGCCACGG - Intergenic
1116285036 14:42959979-42960001 CTAATCACTTTGGGAAGCCAAGG + Intergenic
1117319971 14:54612361-54612383 CTAATGACTCAAAGAAGACTTGG - Intronic
1123509048 15:20977591-20977613 CTCAGCACTTTGAGAAGCCAAGG + Intergenic
1123566271 15:21551338-21551360 CTCAGCACTTTGAGAAGCCAAGG + Intergenic
1123916561 15:25035445-25035467 GTATTGTCTCTGAGCAGCCATGG + Intergenic
1124235827 15:27988789-27988811 TTAGTTACTCTGTGAAGCCAGGG + Intronic
1125041633 15:35194477-35194499 CTGATGACTCAAAGAAGCCTGGG - Intergenic
1126560802 15:50041691-50041713 CCCAGGACTTTGAGAAGCCAAGG + Intronic
1127079758 15:55365661-55365683 CCCAGCACTCTGAGAAGCCAAGG - Intronic
1128062189 15:64742246-64742268 CTGATTCTTCTGAGAAGCCATGG + Intronic
1128208508 15:65873838-65873860 CTCAGCACTCTGAGAGGCCAAGG - Intronic
1128393556 15:67200117-67200139 TAAATGAATCTGACAAGCCATGG + Intergenic
1129513959 15:76145197-76145219 CACATGGCTCTCAGAAGCCATGG - Intronic
1132740114 16:1407953-1407975 CTCAGGACTCTGGGAAGCCTAGG + Intronic
1133641278 16:7719670-7719692 CTCAACACTCTGAGAGGCCAAGG + Intergenic
1133657231 16:7877630-7877652 CTAATGATTCTGAGTAGAAATGG + Intergenic
1134104259 16:11474607-11474629 CCCATTACTTTGAGAAGCCAAGG + Intronic
1135154773 16:20043009-20043031 CTAATTTCTGGGAGAAGCCAGGG - Intronic
1135204244 16:20469310-20469332 CTTAAGACTCTGACAACCCAGGG + Intronic
1135214759 16:20555656-20555678 CTTAAGACTCTGACAACCCAGGG - Intronic
1135338086 16:21621261-21621283 CTCAGCACTCTGGGAAGCCAAGG - Intronic
1135417745 16:22281489-22281511 CCAAAGACTTTGGGAAGCCAAGG - Intronic
1135835765 16:25823812-25823834 CTCATGACTTTGAGAGACCAAGG - Intronic
1135905613 16:26509108-26509130 CAATTCACTCTGGGAAGCCAAGG - Intergenic
1136547297 16:30962694-30962716 CCCAAGACTCTGAGAGGCCAAGG + Intronic
1137285419 16:47012157-47012179 GTAACAACTCTGAGAAGCCATGG + Intergenic
1137658976 16:50187009-50187031 CTCAGCACTCTGAGAAGCCGAGG - Intronic
1138527023 16:57614731-57614753 CTGCTGACTCTGAGGAGGCATGG + Intronic
1141655693 16:85415188-85415210 CCAAGTACTCTGAGAGGCCAAGG - Intergenic
1203143639 16_KI270728v1_random:1785260-1785282 CCAATTTCTCTGGGAAGCCAGGG + Intergenic
1142637889 17:1269248-1269270 CAAATGCCTCTAAGATGCCAAGG - Intergenic
1143002983 17:3806980-3807002 CTAATTCATCTGTGAAGCCATGG + Intergenic
1143251069 17:5523433-5523455 CCAATGACTCAGAGAAACCAAGG - Intronic
1143627027 17:8116384-8116406 CTAAAATCTCTGAGCAGCCAGGG + Intronic
1143669819 17:8388953-8388975 CTAATAATTCTGACTAGCCATGG - Intergenic
1144816780 17:18040189-18040211 CTCATGACTCGGAGAAGGCCTGG + Intronic
1144868455 17:18352568-18352590 CTAAGCACTCTGGGAGGCCAAGG + Intronic
1146914271 17:36668224-36668246 CTAATGAGTCTTTGTAGCCAAGG - Intergenic
1147869215 17:43575758-43575780 CTCATGACTCAGAGGAACCAGGG - Intronic
1148272799 17:46277053-46277075 CTCAACACTTTGAGAAGCCAAGG - Intronic
1148320062 17:46743193-46743215 CAAATGACGCAGAGAGGCCAAGG - Intronic
1148666016 17:49375479-49375501 CCACTGACTCTGAGAAGCACTGG + Intronic
1151090200 17:71430618-71430640 CTAAGCACTTTGGGAAGCCAAGG + Intergenic
1151696214 17:75719283-75719305 CCCAGGACTCCGAGAAGCCAAGG + Intergenic
1152335439 17:79697929-79697951 TTAATAACTCATAGAAGCCAGGG + Intergenic
1152632658 17:81417476-81417498 CAAGTGACTCAGAGCAGCCATGG - Intronic
1154385799 18:13890838-13890860 CTAACGACTGAGAGAAGACATGG - Intronic
1156279805 18:35625906-35625928 CTAAAGAGTCTGAAAAGCAAAGG - Intronic
1157265978 18:46222173-46222195 GTGATGACACTGAGTAGCCAGGG + Intronic
1157271954 18:46283056-46283078 CTAAAGGCACTGGGAAGCCATGG + Intergenic
1157628725 18:49075182-49075204 CTTATGATGATGAGAAGCCAGGG + Intronic
1158733857 18:60057298-60057320 CTCAGGACTCTGAGAAAGCAAGG + Intergenic
1159276025 18:66222634-66222656 GTTATGACTCTGAAAAACCAGGG + Intergenic
1159738785 18:72138811-72138833 CTAAGCACTTTGGGAAGCCAAGG + Intergenic
1160331844 18:78000548-78000570 CTTTTGACTCTGACAGGCCAGGG + Intergenic
1161748082 19:6074082-6074104 CTAATGACCCACAGCAGCCAAGG + Intronic
1161927287 19:7310707-7310729 CTCATGGCTTTGAGAGGCCAAGG - Intergenic
1162074866 19:8179279-8179301 CTCAGTACTCTGAGAGGCCAAGG - Intronic
1162137355 19:8563877-8563899 CTCAGCACTTTGAGAAGCCAAGG - Intronic
1164027459 19:21365704-21365726 CCAAGCACTCTGAGAAGCCTAGG + Intronic
1165673730 19:37703197-37703219 CTCATCACTCTGGGAGGCCAAGG - Intronic
1165944323 19:39432534-39432556 CCCATCACTCTGAGAGGCCAAGG - Intergenic
925920771 2:8636426-8636448 CTAATGACTCAGAAAGTCCAAGG + Intergenic
926560179 2:14408170-14408192 CTAATGACACTGAAAACTCAGGG + Intergenic
928407712 2:31027464-31027486 TTTCTTACTCTGAGAAGCCAAGG + Intronic
928756926 2:34537562-34537584 ATAATCACACTGAGATGCCAAGG - Intergenic
929172275 2:38944049-38944071 CTAATCAATCTGAAAAGCAAAGG - Intronic
929247430 2:39718334-39718356 CAGGTGACTCTGAGCAGCCAAGG - Intergenic
929720851 2:44365610-44365632 CAAAGGACTCTGATAGGCCAAGG + Intronic
931651533 2:64473138-64473160 CTATGGACACTGAGAAGACATGG + Intergenic
932004952 2:67918592-67918614 CTCATCACTTTGAGAGGCCAAGG + Intergenic
932639156 2:73425158-73425180 ATAATGACTATCAGAAGTCAAGG - Intronic
932943792 2:76203052-76203074 CAAATACCTCTGAGAACCCAGGG + Intergenic
932959884 2:76400375-76400397 CTATTTATGCTGAGAAGCCATGG - Intergenic
934895736 2:98117985-98118007 CCCAGGACTCTGAGAGGCCAAGG - Intronic
935544906 2:104390612-104390634 CTACTGTCTCTGAGATCCCAGGG + Intergenic
937649577 2:124305013-124305035 CTCAGCACTCTGAGAGGCCAAGG + Intronic
937737769 2:125312863-125312885 TTCATGAATCTGAGAAGCAAAGG + Intergenic
938306264 2:130257580-130257602 CTAATGACTTTGAAAAGACAAGG + Intergenic
938749682 2:134316828-134316850 CAAATGCCTTTGAGAAGCTAAGG - Intronic
938804208 2:134791072-134791094 CTTAGCACTTTGAGAAGCCAAGG - Intergenic
938843299 2:135183305-135183327 CTCTTGATTCTGAGCAGCCATGG - Intronic
939447611 2:142330476-142330498 CTCATTGTTCTGAGAAGCCAGGG + Intergenic
940889739 2:159023644-159023666 ATAATGACTTTTAAAAGCCATGG - Intronic
941077617 2:161023798-161023820 CTCAAGACTTTGGGAAGCCAAGG + Intergenic
941735379 2:168969382-168969404 CTAGTGACTTTGCAAAGCCAGGG - Exonic
946440379 2:219690306-219690328 CTAATGCTTCTGTGAAGTCAAGG + Intergenic
946538002 2:220652178-220652200 CTCAGCACTATGAGAAGCCAAGG + Intergenic
947379303 2:229529755-229529777 CCCAACACTCTGAGAAGCCAAGG + Intronic
1168754538 20:306975-306997 CCTACCACTCTGAGAAGCCAAGG - Intergenic
1169924538 20:10769030-10769052 CTCATGACTCTGACTTGCCATGG - Intergenic
1170155881 20:13269020-13269042 CTCATGACTCTGAGCGCCCAAGG - Intronic
1170317683 20:15060528-15060550 CCAGTCAATCTGAGAAGCCAAGG - Intronic
1170636655 20:18111551-18111573 CTCAGGACTTTGGGAAGCCAAGG + Intergenic
1171797077 20:29574963-29574985 CTGCTGACTCTTAGAGGCCAAGG + Intergenic
1171851173 20:30309201-30309223 CTGCTGACTCTTAGAGGCCAAGG - Intergenic
1172051983 20:32124835-32124857 CCAAGCACTTTGAGAAGCCAAGG - Intronic
1173626074 20:44473979-44474001 CTCAGCACTTTGAGAAGCCAAGG - Intergenic
1173921161 20:46746386-46746408 CTCAGCACTTTGAGAAGCCAAGG + Intergenic
1176642553 21:9319852-9319874 CCAATGACTTTGGGAGGCCAAGG + Intergenic
1178552053 21:33549321-33549343 CTTAGCACTCTGAGAGGCCAAGG - Intronic
1178620715 21:34172033-34172055 TTAAAGACTCTGAAAAGCAAAGG + Intergenic
1178705065 21:34866187-34866209 CTAAGGACTCTGAGCCCCCAGGG - Intronic
1178994714 21:37388332-37388354 CTCAACACTTTGAGAAGCCAAGG - Intronic
1179023072 21:37657090-37657112 GTGAGGAGTCTGAGAAGCCAAGG + Intronic
1179210888 21:39323408-39323430 CTCAACACTCTGGGAAGCCAGGG + Intergenic
1180740154 22:18047901-18047923 CTCAACACTTTGAGAAGCCAAGG + Intergenic
1182231958 22:28844989-28845011 CTCAACACTCTGGGAAGCCAAGG + Intergenic
1182487393 22:30647597-30647619 ATAATGACTCTGACAAGCACAGG - Exonic
1182914644 22:34018319-34018341 CAAATGACTCTTAGGAGACAAGG - Intergenic
1184415441 22:44349406-44349428 CTCAGGACTCTGTGCAGCCATGG - Intergenic
1184470706 22:44694285-44694307 CCCAGGACTTTGAGAAGCCAAGG + Intronic
1184594188 22:45503993-45504015 CTAGTGGCTCTGAGAAGCCACGG - Intronic
949344431 3:3063685-3063707 CTCAGCACTTTGAGAAGCCAAGG - Intergenic
951214835 3:20014176-20014198 CCAGTCAGTCTGAGAAGCCAGGG - Intergenic
951615939 3:24544167-24544189 AGAAAGAGTCTGAGAAGCCACGG - Intergenic
952453995 3:33455908-33455930 CATATCACTTTGAGAAGCCAAGG - Intergenic
954605075 3:51903171-51903193 CTGAAGACTCTAAGAAGCCCTGG - Intronic
955399436 3:58581117-58581139 GGAAGGACTCTGGGAAGCCAGGG + Intronic
955501419 3:59587769-59587791 CAAAAGACTCTGAAGAGCCAAGG + Intergenic
956208143 3:66775291-66775313 CTAAGCACTTTGGGAAGCCACGG + Intergenic
956817354 3:72920383-72920405 CTCATGACTTTGGGAGGCCAAGG - Intronic
957025510 3:75177336-75177358 CTCAACACTTTGAGAAGCCAAGG - Intergenic
958144218 3:89602994-89603016 CAAATGACACTGAGAAGGAAAGG + Intergenic
959066970 3:101667288-101667310 CCAAGGACTTTGAGATGCCAAGG - Intronic
960186187 3:114642734-114642756 CAAATGAGTCTTAGAACCCAAGG - Intronic
960290340 3:115876833-115876855 GTTATGATTCTGAGAAGACACGG + Intronic
960376592 3:116909799-116909821 CTGAAGCCTCTGAGAAGCCATGG - Intronic
960753794 3:120985262-120985284 ATAATTCCTCTGCGAAGCCATGG + Intronic
960915923 3:122694768-122694790 CTAAGCACTCTGGGAAGCCAAGG - Intronic
962879124 3:139559529-139559551 CTAAGGACCCTGAGAATCCAGGG - Intergenic
962955166 3:140259221-140259243 CTAAGCACTCTGGGAGGCCAAGG + Intronic
964826745 3:160836897-160836919 CTAATGTCTCTAAGAAGGGAAGG - Intronic
965329466 3:167352616-167352638 CTACTCATTCTAAGAAGCCAGGG + Intronic
967298955 3:187993397-187993419 CTAAGTACAGTGAGAAGCCATGG + Intergenic
967568264 3:190996856-190996878 CCAATGAATCTTACAAGCCAGGG - Intergenic
1202744332 3_GL000221v1_random:85166-85188 CCAATGACTTTGGGAGGCCAAGG - Intergenic
969332568 4:6486826-6486848 ATAATCACTTTGAGCAGCCATGG - Intronic
971609673 4:28706976-28706998 CTAATGCCTCCCAGTAGCCATGG + Intergenic
976160395 4:82192493-82192515 CAAAGGACTCTGTGAAGCAAAGG + Intergenic
977452410 4:97215595-97215617 CGAAAGACTCTGAGAAACCCTGG + Intronic
977471327 4:97447411-97447433 CTAAGGTCTCTGACATGCCATGG - Intronic
978262650 4:106779862-106779884 TTAATGACTGTCAGAGGCCATGG - Intergenic
980079979 4:128333908-128333930 CTAAATGCACTGAGAAGCCATGG + Intergenic
980598132 4:134982756-134982778 CTAATGAGACTGAGAAGAAAGGG - Intergenic
981301775 4:143194756-143194778 CTCAGCACTCTGGGAAGCCAAGG - Intronic
982153889 4:152495924-152495946 CTCAGCACTCTGGGAAGCCAAGG + Intronic
982573708 4:157081594-157081616 CTACTGAATTTGAGAAGCTAAGG - Intronic
984764648 4:183390498-183390520 CCAAACACTTTGAGAAGCCAAGG - Intergenic
988390808 5:30627615-30627637 ATAATGACTCTGTGAAGTTAGGG + Intergenic
988537949 5:32085807-32085829 CAAAGGACTCTGAATAGCCAAGG - Intronic
990342309 5:54835517-54835539 CTGAAGTCTCTGAGAAGTCATGG + Intergenic
992701776 5:79348207-79348229 CTCAGGACTTTGAGAGGCCAAGG - Intergenic
998481357 5:142465870-142465892 CTAAAGCCTCTGTGGAGCCATGG - Intergenic
999729943 5:154469149-154469171 CTCAAGACTTTGGGAAGCCAAGG - Intergenic
1000473667 5:161678022-161678044 CTAATTGCTCTGGGAAGCAAAGG - Intronic
1000481100 5:161775397-161775419 CTCAGCACTTTGAGAAGCCAAGG - Intergenic
1002366259 5:178714399-178714421 CCTTTGACTCTGAGCAGCCACGG + Intronic
1003186143 6:3832505-3832527 CCACTGCATCTGAGAAGCCAGGG - Intergenic
1005109446 6:22263980-22264002 CTAATGACTAAGAGGAGGCAGGG - Intergenic
1006172431 6:32101673-32101695 CTAATAACTTTGGGAGGCCAAGG - Intronic
1006409855 6:33866715-33866737 CTGAGGACTCTCAGAAGCAAGGG - Intergenic
1006865968 6:37209310-37209332 CTCAGCACTCTGGGAAGCCAAGG + Intergenic
1007502935 6:42312550-42312572 ATAACCACTCTGAGAGGCCAAGG - Intronic
1008691556 6:53984767-53984789 CCAAAAACTCTCAGAAGCCATGG - Intronic
1009881099 6:69566942-69566964 CAATTGACCCTGAGAAGCCCTGG - Intergenic
1013172596 6:107650191-107650213 CCTATGGCTCTGAGAAGCTAAGG - Intronic
1015473546 6:133633984-133634006 CTTATGAAGCTGAGAAGACAAGG + Intergenic
1015936572 6:138410734-138410756 CTCAACACTTTGAGAAGCCAAGG - Intronic
1018535499 6:164814441-164814463 CTAAGGACTCTGACATGCCCTGG + Intergenic
1020222267 7:6248660-6248682 CTGATGACCCTGAGTGGCCACGG - Intronic
1021694683 7:23265231-23265253 CTGACGATTCTGAGAAGCCCTGG + Intronic
1021791939 7:24214758-24214780 ATAAAGACACAGAGAAGCCAAGG + Intergenic
1022507925 7:30918240-30918262 CCCAGCACTCTGAGAAGCCAAGG - Intronic
1022834630 7:34102056-34102078 CTAATGTGACTGAAAAGCCAGGG + Intronic
1023008819 7:35906742-35906764 CTAATGAGTCTGAGAGGCATGGG - Exonic
1023340009 7:39210084-39210106 TTAAAGACTCTGAAAAGCCTTGG - Intronic
1023422303 7:39994125-39994147 CAACAGACTCTGAGAAGCAAAGG - Intronic
1024044642 7:45578461-45578483 CTACTGACTGTGAGCAGCCAAGG - Intronic
1024838317 7:53551672-53551694 CTGATGAATCTGAGAATCTAAGG - Intergenic
1024962893 7:54996123-54996145 CCAATGCTGCTGAGAAGCCACGG - Intergenic
1025772645 7:64527715-64527737 CCCAGGACTTTGAGAAGCCAAGG + Intronic
1026277216 7:68890609-68890631 CTAATGACACTGTCAAGGCAAGG + Intergenic
1027221927 7:76219656-76219678 CTCAGCACTCTGGGAAGCCAAGG + Intronic
1028855831 7:95592351-95592373 CTACTGACTCTCAAAAGCAAAGG + Intronic
1030257625 7:107528771-107528793 TTAAAAGCTCTGAGAAGCCAGGG + Intronic
1030724721 7:112913335-112913357 GTAATGACTCAGAGGAGCCAGGG - Intronic
1031492694 7:122408675-122408697 CTCAGCACTCTGAGAGGCCAAGG - Intronic
1031701805 7:124935367-124935389 CTAGTGATTCTGAAAAGACAGGG + Intergenic
1032347580 7:131131103-131131125 CTCAGGACTTTGGGAAGCCAAGG + Intronic
1035953027 8:4044934-4044956 ATAATTACTCTCAGATGCCATGG - Intronic
1037315722 8:17597269-17597291 CTCAGGACTTTGAGAGGCCAAGG - Intronic
1037590686 8:20309701-20309723 CTGATGCCACTGGGAAGCCAAGG - Intergenic
1037625327 8:20601465-20601487 ACAAAGGCTCTGAGAAGCCAAGG - Intergenic
1038706132 8:29895834-29895856 CTCATGACTCTGCCAAGCCAAGG + Intergenic
1039118399 8:34117850-34117872 CTGATGTCTCTTAGAAGCCTAGG + Intergenic
1039240754 8:35553888-35553910 TGAATGACACTGAGAAGCCAAGG + Intronic
1040848721 8:51875685-51875707 CTCAGCACTCTGGGAAGCCAAGG + Intronic
1043215617 8:77583807-77583829 CCATTGAGCCTGAGAAGCCAAGG - Intergenic
1043337472 8:79194154-79194176 CTAATAACTCTGAGAGGGAAGGG + Intergenic
1044135690 8:88583132-88583154 CCAATGACTCTATGAAGCAATGG - Intergenic
1044302431 8:90601007-90601029 CAAATGCTTCTGAGAAGGCAAGG + Intergenic
1045603036 8:103739810-103739832 CTAGAGACTCTGAGAAGCAGAGG - Intronic
1046522535 8:115343750-115343772 CTAATGTCTCTGACTAGTCAAGG - Intergenic
1046911768 8:119635935-119635957 TTGAGGACTCTGAGAAGCTATGG + Intronic
1046940206 8:119923490-119923512 CTCAGGACTTTGGGAAGCCAAGG - Intronic
1047304541 8:123642283-123642305 CAAAGGTCTCTGAGAAGCCATGG + Intergenic
1047659552 8:127018248-127018270 CAAATGAATGGGAGAAGCCAAGG - Intergenic
1047978279 8:130153451-130153473 CATATGAGTCTGAGAAGTCAAGG - Intronic
1051212417 9:14758573-14758595 CAAATCACTCTCAGAAGCCTGGG - Intronic
1052924042 9:33999217-33999239 CTCATGCCTTTGGGAAGCCAAGG + Intronic
1053788947 9:41672481-41672503 CTGCTGACTCTTAGAGGCCAAGG - Intergenic
1054156192 9:61642286-61642308 CTGCTGACTCTTAGAGGCCAAGG + Intergenic
1054177229 9:61883826-61883848 CTGCTGACTCTTAGAGGCCAAGG - Intergenic
1054475963 9:65573287-65573309 CTGCTGACTCTTAGAGGCCAAGG + Intergenic
1054660304 9:67696979-67697001 CTGCTGACTCTTAGAGGCCAAGG + Intergenic
1055146916 9:72946864-72946886 GTAATGACTCTGAAATGGCATGG - Intronic
1055424350 9:76178600-76178622 ATAATGACTCAAAGAAACCAAGG + Intronic
1055805946 9:80093477-80093499 CTCAGCACTTTGAGAAGCCAAGG + Intergenic
1056813902 9:89786363-89786385 CTAAAGAGTCTGAAAAGCAAAGG + Intergenic
1057666113 9:97046667-97046689 CTCATGGTTCTGAGAAGCCCAGG + Intergenic
1059302137 9:113322648-113322670 CTAATAACCCTGAGAGGCCAGGG + Intronic
1061293968 9:129667045-129667067 CTCCTGTCTCTGAAAAGCCAAGG - Intronic
1061612044 9:131753477-131753499 CTCATCACTCTGGGAGGCCAAGG - Intergenic
1062017422 9:134297788-134297810 CCAAAGACTCCAAGAAGCCAAGG - Intergenic
1062032492 9:134367985-134368007 CAAATTACTCTGAGCAGGCAGGG - Intronic
1203712964 Un_KI270742v1:115115-115137 CCAATGACTTTGGGAGGCCAAGG - Intergenic
1188181295 X:27059237-27059259 CTAATTAATCTGAGAAGCAAAGG - Intergenic
1188804909 X:34576181-34576203 CTATGAACTCTGAGAAGGCAGGG - Intergenic
1189366090 X:40389806-40389828 CTTTGTACTCTGAGAAGCCAGGG + Intergenic
1190019330 X:46858721-46858743 CCAAGCACTCTGAGAGGCCAAGG - Intronic
1193553899 X:82930924-82930946 CTAATGACTTTGAGACCCCCTGG - Intergenic
1194002148 X:88443727-88443749 CCAAGAACACTGAGAAGCCAGGG - Intergenic
1194403761 X:93468605-93468627 CTAATCACTCTGATCAGCTATGG + Intergenic
1194504792 X:94720981-94721003 CCTATCACTTTGAGAAGCCAAGG + Intergenic
1195475891 X:105284831-105284853 TTAATGACTGAGTGAAGCCAGGG + Intronic
1196575270 X:117310073-117310095 ATAATGCCTCTCAGAAGCAAGGG - Intergenic
1197171696 X:123442164-123442186 CTATGGACTATGGGAAGCCATGG - Intronic
1199937707 X:152591807-152591829 CTCATGACTCAGAGAAGGAAAGG + Intergenic
1201261682 Y:12164800-12164822 CTCATCACTTTGAGAGGCCAAGG + Intergenic
1201490656 Y:14537695-14537717 CTCAGCACTTTGAGAAGCCAAGG + Intronic