ID: 1065179059

View in Genome Browser
Species Human (GRCh38)
Location 10:23106769-23106791
Sequence CTTCTCAGAGTCATTAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065179049_1065179059 16 Left 1065179049 10:23106730-23106752 CCCTCTTCCTTTGTCCCACAGGC 0: 1
1: 0
2: 1
3: 26
4: 422
Right 1065179059 10:23106769-23106791 CTTCTCAGAGTCATTAGCCCAGG No data
1065179050_1065179059 15 Left 1065179050 10:23106731-23106753 CCTCTTCCTTTGTCCCACAGGCC 0: 1
1: 0
2: 2
3: 26
4: 326
Right 1065179059 10:23106769-23106791 CTTCTCAGAGTCATTAGCCCAGG No data
1065179051_1065179059 9 Left 1065179051 10:23106737-23106759 CCTTTGTCCCACAGGCCTAGTGG No data
Right 1065179059 10:23106769-23106791 CTTCTCAGAGTCATTAGCCCAGG No data
1065179057_1065179059 -6 Left 1065179057 10:23106752-23106774 CCTAGTGGAGGCCATGGCTTCTC No data
Right 1065179059 10:23106769-23106791 CTTCTCAGAGTCATTAGCCCAGG No data
1065179055_1065179059 1 Left 1065179055 10:23106745-23106767 CCACAGGCCTAGTGGAGGCCATG 0: 1
1: 0
2: 2
3: 17
4: 187
Right 1065179059 10:23106769-23106791 CTTCTCAGAGTCATTAGCCCAGG No data
1065179047_1065179059 21 Left 1065179047 10:23106725-23106747 CCACTCCCTCTTCCTTTGTCCCA 0: 1
1: 0
2: 5
3: 106
4: 1224
Right 1065179059 10:23106769-23106791 CTTCTCAGAGTCATTAGCCCAGG No data
1065179054_1065179059 2 Left 1065179054 10:23106744-23106766 CCCACAGGCCTAGTGGAGGCCAT 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1065179059 10:23106769-23106791 CTTCTCAGAGTCATTAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065179059 Original CRISPR CTTCTCAGAGTCATTAGCCC AGG Intronic
No off target data available for this crispr