ID: 1065179063

View in Genome Browser
Species Human (GRCh38)
Location 10:23106791-23106813
Sequence GGATGCGTTGCCCTCACTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065179057_1065179063 16 Left 1065179057 10:23106752-23106774 CCTAGTGGAGGCCATGGCTTCTC No data
Right 1065179063 10:23106791-23106813 GGATGCGTTGCCCTCACTTGTGG No data
1065179055_1065179063 23 Left 1065179055 10:23106745-23106767 CCACAGGCCTAGTGGAGGCCATG 0: 1
1: 0
2: 2
3: 17
4: 187
Right 1065179063 10:23106791-23106813 GGATGCGTTGCCCTCACTTGTGG No data
1065179058_1065179063 5 Left 1065179058 10:23106763-23106785 CCATGGCTTCTCAGAGTCATTAG 0: 1
1: 0
2: 2
3: 20
4: 303
Right 1065179063 10:23106791-23106813 GGATGCGTTGCCCTCACTTGTGG No data
1065179054_1065179063 24 Left 1065179054 10:23106744-23106766 CCCACAGGCCTAGTGGAGGCCAT 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1065179063 10:23106791-23106813 GGATGCGTTGCCCTCACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065179063 Original CRISPR GGATGCGTTGCCCTCACTTG TGG Intronic
No off target data available for this crispr