ID: 1065179066

View in Genome Browser
Species Human (GRCh38)
Location 10:23106802-23106824
Sequence CCTCACTTGTGGATTTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065179057_1065179066 27 Left 1065179057 10:23106752-23106774 CCTAGTGGAGGCCATGGCTTCTC No data
Right 1065179066 10:23106802-23106824 CCTCACTTGTGGATTTCCATTGG No data
1065179058_1065179066 16 Left 1065179058 10:23106763-23106785 CCATGGCTTCTCAGAGTCATTAG 0: 1
1: 0
2: 2
3: 20
4: 303
Right 1065179066 10:23106802-23106824 CCTCACTTGTGGATTTCCATTGG No data
1065179061_1065179066 -7 Left 1065179061 10:23106786-23106808 CCCAGGGATGCGTTGCCCTCACT 0: 1
1: 0
2: 1
3: 3
4: 87
Right 1065179066 10:23106802-23106824 CCTCACTTGTGGATTTCCATTGG No data
1065179062_1065179066 -8 Left 1065179062 10:23106787-23106809 CCAGGGATGCGTTGCCCTCACTT 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1065179066 10:23106802-23106824 CCTCACTTGTGGATTTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065179066 Original CRISPR CCTCACTTGTGGATTTCCAT TGG Intronic
No off target data available for this crispr