ID: 1065187906

View in Genome Browser
Species Human (GRCh38)
Location 10:23187278-23187300
Sequence AAAAGCAATCTGCCCAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065187902_1065187906 10 Left 1065187902 10:23187245-23187267 CCTTTCTAAATCTGTTTCCACCT No data
Right 1065187906 10:23187278-23187300 AAAAGCAATCTGCCCAAGCTGGG No data
1065187900_1065187906 23 Left 1065187900 10:23187232-23187254 CCAAGCCAGTTAGCCTTTCTAAA No data
Right 1065187906 10:23187278-23187300 AAAAGCAATCTGCCCAAGCTGGG No data
1065187901_1065187906 18 Left 1065187901 10:23187237-23187259 CCAGTTAGCCTTTCTAAATCTGT No data
Right 1065187906 10:23187278-23187300 AAAAGCAATCTGCCCAAGCTGGG No data
1065187904_1065187906 -10 Left 1065187904 10:23187265-23187287 CCTGTGAATGATGAAAAGCAATC No data
Right 1065187906 10:23187278-23187300 AAAAGCAATCTGCCCAAGCTGGG No data
1065187903_1065187906 -7 Left 1065187903 10:23187262-23187284 CCACCTGTGAATGATGAAAAGCA No data
Right 1065187906 10:23187278-23187300 AAAAGCAATCTGCCCAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065187906 Original CRISPR AAAAGCAATCTGCCCAAGCT GGG Intergenic
No off target data available for this crispr