ID: 1065188957

View in Genome Browser
Species Human (GRCh38)
Location 10:23193333-23193355
Sequence CAGCTCAGGGAGAAGGGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1545
Summary {0: 1, 1: 1, 2: 5, 3: 75, 4: 1463}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065188946_1065188957 -2 Left 1065188946 10:23193312-23193334 CCCGTAAGTGCTTCCGCTTCCCA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG 0: 1
1: 1
2: 5
3: 75
4: 1463
1065188945_1065188957 9 Left 1065188945 10:23193301-23193323 CCATCGGGGCACCCGTAAGTGCT 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG 0: 1
1: 1
2: 5
3: 75
4: 1463
1065188947_1065188957 -3 Left 1065188947 10:23193313-23193335 CCGTAAGTGCTTCCGCTTCCCAG 0: 1
1: 0
2: 1
3: 5
4: 146
Right 1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG 0: 1
1: 1
2: 5
3: 75
4: 1463
1065188940_1065188957 28 Left 1065188940 10:23193282-23193304 CCCAGAAGGTCATCATCTGCCAT 0: 1
1: 0
2: 20
3: 46
4: 222
Right 1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG 0: 1
1: 1
2: 5
3: 75
4: 1463
1065188941_1065188957 27 Left 1065188941 10:23193283-23193305 CCAGAAGGTCATCATCTGCCATC 0: 1
1: 0
2: 2
3: 39
4: 165
Right 1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG 0: 1
1: 1
2: 5
3: 75
4: 1463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065188957 Original CRISPR CAGCTCAGGGAGAAGGGGTC GGG Intronic
900121148 1:1049170-1049192 CAGCTCAGGTAGGCGGGGTGGGG + Intronic
900387639 1:2417777-2417799 CAGCCCTGGGAGGAGGGGACGGG + Intergenic
900403066 1:2480556-2480578 CAGCTCTGGGGAAAGTGGTCGGG + Intronic
900476723 1:2879585-2879607 CAGCTGAGCAAGAAGGGGTCAGG - Intergenic
900548844 1:3243532-3243554 CAGCTCAGGAGGCAGAGGTCGGG - Intronic
901065625 1:6492905-6492927 GGGCACAGGGAGAAGGGGACGGG - Intronic
901534120 1:9871642-9871664 CAGCTCAGGGACAACTTGTCAGG - Intronic
902776291 1:18676862-18676884 CAGCCCCCTGAGAAGGGGTCTGG - Intronic
902984900 1:20149304-20149326 CAGCCCAGGGAGAGAGGGTGTGG - Exonic
902984927 1:20149398-20149420 CAGCCCAGGGAGAGAGGGTGTGG - Exonic
903100488 1:21024397-21024419 CAGCTCATTGAGAATGGGCCAGG + Intronic
903318814 1:22529377-22529399 GAGCTCTGGGAGCAGAGGTCTGG - Exonic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903372966 1:22848726-22848748 CATCTCTGGGAGAAGGGATTAGG - Intronic
903395318 1:22997607-22997629 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
903485969 1:23689259-23689281 CAGCTCATTGAGAACGGGCCGGG + Intergenic
903525807 1:23993207-23993229 CAGCTCATTGAGAACGGGCCAGG - Intergenic
903531140 1:24031914-24031936 CAGCTCATTGAGAACGGGCCAGG - Intergenic
903732596 1:25507280-25507302 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
903924095 1:26819170-26819192 CAGCTCATTGAGAACGGGCCAGG + Intergenic
903993192 1:27288838-27288860 CAGCTCATTGAGAACGGGCCAGG - Intronic
904078068 1:27854590-27854612 CAGCTCATTGAGAACGGGCCAGG + Intergenic
904371206 1:30048556-30048578 CAGCTCAGGGAGAGGTGGACAGG - Intergenic
904795458 1:33052973-33052995 CAGCTCATTGAGAACGGGCCAGG + Intronic
904899061 1:33841966-33841988 TAGCTCAGGGAAGAAGGGTCTGG - Intronic
905598992 1:39234277-39234299 CAGCTCATTGAGAACGGGCCAGG - Intronic
905699444 1:40000131-40000153 CAGCTCATTGAGAACGGGCCAGG + Intergenic
905825769 1:41025004-41025026 CACATCAGGGAGAAGGGGGTTGG - Intergenic
906049671 1:42859760-42859782 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
906081386 1:43091038-43091060 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
906084497 1:43119815-43119837 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
906136333 1:43502467-43502489 CAGCTCATTGAGAACGGGCCGGG + Intergenic
906353333 1:45081834-45081856 CAGCTCATTGAGAACGGGCCAGG + Intronic
906400049 1:45497887-45497909 CAGCTCATTGAGAACGGGCCAGG + Intronic
906487421 1:46242441-46242463 CAGCTCATTGAGAACGGGCCAGG + Intergenic
906742202 1:48193135-48193157 CAGCTCATTGAGAACGGGCCAGG + Intergenic
906770714 1:48479744-48479766 CAGCTCATTGAGAACGGGCCGGG + Intergenic
906828485 1:49006712-49006734 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
906851717 1:49257870-49257892 CTGCTCAGGGATCAGGGGTCAGG - Intronic
907089474 1:51711194-51711216 CAGCTCATTGAGAACGGGCCAGG - Intronic
907402649 1:54233856-54233878 CAGCTCACTGAGAACGGGCCAGG + Intronic
907414273 1:54303374-54303396 CAGCCCAGGGGGCAGGGGGCAGG + Intronic
907453368 1:54561590-54561612 CAGCTCATTGAGAACGGGCCAGG - Intronic
907631833 1:56090344-56090366 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
907722685 1:56986812-56986834 CAGCACACAGAGAAGGGGTTTGG - Intergenic
908468259 1:64416028-64416050 CAGCTCATTGAGAACGGGCCGGG + Intergenic
908665149 1:66481621-66481643 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
908765348 1:67549647-67549669 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
908768015 1:67571548-67571570 CAGCTGAAGGAGAAGGGGCTGGG + Intergenic
908915345 1:69119793-69119815 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
908975101 1:69887924-69887946 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
909349266 1:74630477-74630499 CAGCTCAGAATGAAGGAGTCTGG - Intronic
909421987 1:75476961-75476983 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
909441235 1:75698338-75698360 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
909846395 1:80399776-80399798 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
910049930 1:82961473-82961495 CAGCTAAGGGAGATGGGGTGGGG - Intergenic
910068493 1:83182872-83182894 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
910157336 1:84234220-84234242 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
910344171 1:86216824-86216846 CAGCTCATTGAGAACGGGCCAGG + Intergenic
910610241 1:89133713-89133735 CAGCTCCTGGGGAAGGGGTGAGG + Intronic
910714770 1:90219130-90219152 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
911071726 1:93836964-93836986 CAGCGAAGGGAGATGGGGTGGGG - Intronic
911213707 1:95168939-95168961 CAGCTAAGAGTTAAGGGGTCAGG + Intronic
911359397 1:96858640-96858662 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
912009391 1:104940453-104940475 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
912302892 1:108535964-108535986 CAGCTCATTGAGAACGGGCCAGG - Intergenic
912640030 1:111335909-111335931 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
912690317 1:111800048-111800070 CAGCTCATTGAGAACGGGCCAGG + Intronic
912730892 1:112102478-112102500 AAGCTCAGGGAGCAGGAGTAAGG - Intergenic
912736244 1:112151899-112151921 CAGCCCAGACAGATGGGGTCTGG + Intergenic
912741718 1:112204581-112204603 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
912790084 1:112640728-112640750 CAGCTCATTGAGAACGGGCCAGG + Intronic
912808400 1:112774467-112774489 CAGCTCATTGAGAACGGGCCTGG + Intergenic
912825053 1:112898111-112898133 CAGCTCATTGAGAACGGGCCAGG - Intergenic
912845383 1:113070639-113070661 CAGCTCATTGAGAACGGGCCAGG + Intergenic
912900080 1:113638664-113638686 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
913021056 1:114790449-114790471 CAGCTCATTGAGAACGGGCCAGG - Intergenic
913039820 1:115011430-115011452 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
913305729 1:117429290-117429312 CAGCTCACTGAGAACGGGCCAGG - Intronic
913609635 1:120497419-120497441 AAGCTGAGAGAGAAGGAGTCTGG + Intergenic
913645504 1:120850554-120850576 GAGCTCAGGGATCAAGGGTCGGG - Intergenic
913719249 1:121574990-121575012 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
914081224 1:144412983-144413005 GAGCTCAGGGATCAAGGGTCGGG + Intergenic
914176133 1:145281523-145281545 GAGCTCAGGGATCAAGGGTCGGG + Intergenic
914530859 1:148523008-148523030 GAGCTCAGGGATCAAGGGTCGGG + Intergenic
914581555 1:149024425-149024447 AAGCTGAGAGAGAAGGAGTCTGG - Exonic
914774960 1:150728436-150728458 CAGCTCATTGAGAACGGGCCAGG - Intergenic
914893697 1:151651089-151651111 CAGCTCATTGAGAACGGGCCAGG - Intronic
915411092 1:155701185-155701207 CAGCTCATTGAGAACGGGCCAGG + Intronic
915753682 1:158237333-158237355 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
916020088 1:160783781-160783803 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
916608161 1:166363553-166363575 CAGCTCTGGGAGAGGTGGCCAGG - Intergenic
916676567 1:167068848-167068870 CAGCACAGGGAGAAGAGCCCAGG - Intronic
916942301 1:169688600-169688622 CAGCAAAGGGAGATGGGGTGGGG - Intronic
917092947 1:171372262-171372284 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
917093182 1:171374250-171374272 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
917375517 1:174348946-174348968 CAGCTCATTGAGAACGGGCCAGG - Intronic
917549314 1:176007650-176007672 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
917575122 1:176313686-176313708 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
917718309 1:177760103-177760125 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
917976812 1:180245139-180245161 AGGCTGAGGGAGGAGGGGTCAGG - Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918228486 1:182509174-182509196 CAGCTCATTGAGAACGGGCCAGG - Intronic
918511159 1:185316331-185316353 AAGCGCGGGGAGAAGGGGGCGGG - Intronic
918521531 1:185420322-185420344 CAGCTGAGGGACAAGAGCTCCGG + Intergenic
918680611 1:187349075-187349097 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
918700221 1:187598366-187598388 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
919119885 1:193326145-193326167 TATATCTGGGAGAAGGGGTCAGG - Intergenic
919761480 1:201100696-201100718 ATGCTCAGGGTGAAGGGGGCTGG + Intronic
919783500 1:201239539-201239561 CTGCTCAGGGATCAGGGGTCAGG + Intergenic
919925750 1:202191310-202191332 CAGCTCATTGAGAACGGGCCAGG - Intergenic
919994850 1:202739962-202739984 CAGCTCATTGAGAACGGGCCGGG - Intronic
920132308 1:203741642-203741664 CAGCTCAGGTGAAAGGGGTGAGG - Exonic
920451763 1:206064783-206064805 CAGCTCATTGAGAACGGGCCAGG + Intronic
920749371 1:208659424-208659446 CAGCTCATTGAGAACGGGCCAGG - Intergenic
920885025 1:209919104-209919126 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
920964419 1:210690342-210690364 CAGCTCTGGGAGAAGAGGCCTGG - Intronic
921167667 1:212518571-212518593 TAGCTGAGGGAGGAGGGGGCAGG + Intergenic
921307101 1:213808211-213808233 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
921547174 1:216486339-216486361 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
921679519 1:218014534-218014556 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
921902569 1:220466171-220466193 CAGCTCATTGAGAACGGGCCAGG - Intergenic
922102925 1:222488875-222488897 CAGCTCATTGAGAACGGGCCGGG + Intergenic
922197428 1:223371975-223371997 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
922960422 1:229641471-229641493 CAGCTCAGGTGGAAGAGGCCTGG - Intronic
923074888 1:230601523-230601545 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
923513537 1:234674377-234674399 GGGCTCCGGGAGAAGGGGCCAGG + Intergenic
923599186 1:235387230-235387252 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
923711127 1:236387505-236387527 CAGCTCATTGAGAACGGGCCAGG + Intronic
923781061 1:237024777-237024799 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
923792882 1:237127272-237127294 CAGCTCATTGAGAACGGGCCAGG - Intronic
924178326 1:241415745-241415767 CAGCTCATTGAGAACGGGCCAGG + Intergenic
924872915 1:248068205-248068227 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
924882070 1:248171870-248171892 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
924912492 1:248528648-248528670 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
924925677 1:248677068-248677090 CAGCTCATTGAGAACGGGCCGGG + Intergenic
924954197 1:248911605-248911627 CAGCTCATTGAGAACGGGCCAGG - Intronic
1062923364 10:1296598-1296620 GAGGGCAGGGGGAAGGGGTCAGG + Intronic
1062924279 10:1302713-1302735 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1063362778 10:5471054-5471076 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1063363666 10:5476889-5476911 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1063897324 10:10696309-10696331 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1064234603 10:13562606-13562628 CTGCTGAGGGAGAAGGGTGCTGG + Intergenic
1064663399 10:17628837-17628859 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1064761735 10:18628090-18628112 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1064794219 10:18993276-18993298 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1064840530 10:19586532-19586554 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1065012316 10:21430706-21430728 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1065336480 10:24657557-24657579 CAGCTCATTGAGAACGGGCCAGG + Intronic
1065397245 10:25252620-25252642 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1065594150 10:27296049-27296071 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1065916044 10:30355778-30355800 CAGCCCAGGGATCAGGGGGCAGG - Intronic
1065985575 10:30948084-30948106 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1066290854 10:34013203-34013225 CAGCTGCAGGAGCAGGGGTCTGG - Intergenic
1066786020 10:39005063-39005085 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1067354668 10:45512731-45512753 CAGCTCATTGAGAACGGGCCGGG + Intronic
1067360060 10:45571448-45571470 CAGCAAAGGGAGAAAGGGTGGGG - Intronic
1067698665 10:48553231-48553253 CAGTTCAGGGAGAGCGGGACGGG - Intronic
1068050775 10:51946894-51946916 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1068360524 10:55971776-55971798 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1069084290 10:64120982-64121004 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1069148428 10:64924932-64924954 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
1069740899 10:70686773-70686795 CAGCTCATTGAGAACGGGCCAGG - Intronic
1069771746 10:70904831-70904853 AAGCTGGGGGAGAAGGGGTGAGG + Intergenic
1070202184 10:74217579-74217601 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1070317812 10:75332963-75332985 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1070347928 10:75563964-75563986 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1070794843 10:79210483-79210505 GAGCTCTGGGAGAAGGGGCAAGG + Intronic
1070828692 10:79405736-79405758 CAGCCCTGGGAGGAGGGGACAGG + Intronic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1072010805 10:91301449-91301471 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1072011630 10:91307021-91307043 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1072117381 10:92376939-92376961 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1072149470 10:92674218-92674240 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1072377206 10:94829961-94829983 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1072567378 10:96628228-96628250 GAGCTCAGGGTAGAGGGGTCGGG + Intronic
1072648873 10:97277103-97277125 CAGCTCATTGAGAACGGGCCAGG + Intronic
1072949240 10:99837960-99837982 CAGCTCATTGAGAACGGGCCAGG - Intronic
1072954255 10:99874884-99874906 CAGCTCAGGCAGTTGGGGGCAGG - Intergenic
1072956616 10:99892264-99892286 CAGCTCATTGAGAACGGGCCAGG + Intronic
1072980628 10:100094051-100094073 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1073386562 10:103130061-103130083 CAGCTCATTGAGAACGGGCCAGG + Intronic
1073444666 10:103573615-103573637 AGGCTCAGGCAGAAGTGGTCAGG - Intronic
1073594282 10:104784934-104784956 CAGCTCATTGAGAACGGGCCAGG - Intronic
1073963582 10:108962363-108962385 CAGCTCAGTGCTAAGGGGTAAGG + Intergenic
1073987347 10:109224310-109224332 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1074042129 10:109800836-109800858 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1074044698 10:109826524-109826546 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1074060474 10:109960880-109960902 CTGCCCAGGGAGAAGGGGAGGGG + Intergenic
1075128995 10:119722582-119722604 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1075413191 10:122244175-122244197 CACATCAGGGAGCAGGGGTGGGG - Intronic
1076350441 10:129811546-129811568 CAGCACCGGGAGAAGGGGGCAGG - Intergenic
1076995026 11:293635-293657 GGACTCAGGGAGAAGGGGACTGG - Exonic
1077315911 11:1919295-1919317 CATCTCAGAGAGAAGGGGCGGGG + Intergenic
1077363397 11:2151222-2151244 GAGAGCAGGGAGAAGCGGTCAGG + Intronic
1077373526 11:2194778-2194800 GAGCTCAGGGTGCAGGGGCCAGG - Intergenic
1077397713 11:2332970-2332992 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1077542965 11:3156141-3156163 CAGCCCAGCGAGATGGGGCCTGG - Intronic
1078078967 11:8190295-8190317 CAGCTCAGGAAGCAGGTGTGGGG - Intergenic
1078552482 11:12290135-12290157 CAGCCCAGGGACAAGGGGCTCGG + Intronic
1079039614 11:17050089-17050111 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1079174025 11:18121506-18121528 CAGCTCATTGAGAACGGGCCAGG + Intronic
1079471302 11:20780749-20780771 AAGCTGAAGGAGAAGGAGTCAGG + Intronic
1079726612 11:23887362-23887384 CAGATAAGGGAGATGGGGTTGGG + Intergenic
1079822357 11:25146723-25146745 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1079832031 11:25280751-25280773 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1079895526 11:26114205-26114227 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1079922687 11:26451794-26451816 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1080227058 11:29973673-29973695 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1080705850 11:34692122-34692144 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1081169306 11:39847354-39847376 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1081172099 11:39881761-39881783 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1081289318 11:41305410-41305432 CAGCTCATTGAGAACGGGCCAGG + Intronic
1081442949 11:43100429-43100451 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1081666301 11:44918883-44918905 CAGCTCAGGTGGAAGGGGTGGGG + Intronic
1081784546 11:45738014-45738036 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1081814973 11:45934005-45934027 CAGCTCTGGGAGGAGGGGGAAGG + Exonic
1081956594 11:47097813-47097835 CAGCTCATTGAGAACGGGCCAGG + Intronic
1082642902 11:55686339-55686361 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1082744272 11:56945449-56945471 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1082844431 11:57716070-57716092 CAGCTCATTGAGAACGGGCCGGG - Intronic
1082965903 11:58965938-58965960 CACCTAAGAGACAAGGGGTCTGG + Intronic
1083115159 11:60451904-60451926 CAGCTCATTGAGAACGGGCCAGG + Intronic
1083154835 11:60815863-60815885 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1083190870 11:61051421-61051443 CAGCACAGAGAGCAGGGGCCTGG + Intergenic
1083353055 11:62044819-62044841 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1083382759 11:62279801-62279823 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1083534256 11:63454078-63454100 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1083645594 11:64171239-64171261 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1083658914 11:64243134-64243156 CAGCTGAGGGAGGGGGTGTCAGG + Intronic
1083832205 11:65239809-65239831 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1084049258 11:66588601-66588623 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1084140178 11:67222561-67222583 CAGCTCATTGAGAACGGGCCAGG - Intronic
1084353705 11:68623078-68623100 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1084355229 11:68634049-68634071 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1084585261 11:70057527-70057549 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1084624102 11:70295042-70295064 CAGCTCATTGAGAACGGGCCAGG - Intronic
1084924506 11:72502001-72502023 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1085512976 11:77097958-77097980 CAGCTCATTGAGAACGGGCCAGG - Intronic
1085563354 11:77490635-77490657 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1085739782 11:79068986-79069008 CAGCTCTGGGTGAAGGGGGGTGG + Intronic
1085772850 11:79340304-79340326 CAGCCCAGGGAGGTGGGGTCAGG + Intronic
1085901075 11:80700292-80700314 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1086125572 11:83345287-83345309 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1086329932 11:85743884-85743906 CAGCTGAGGGAGGAGGGAGCAGG - Intronic
1086366449 11:86111632-86111654 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1086465448 11:87048000-87048022 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1086519934 11:87657995-87658017 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1086549926 11:88043679-88043701 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1086687045 11:89744884-89744906 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1086786070 11:90971582-90971604 CTGCTCAGGGGCCAGGGGTCAGG + Intergenic
1086870145 11:92027585-92027607 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1086882891 11:92170103-92170125 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1086955968 11:92934771-92934793 CACCTCAGGGAGAAGAGACCAGG + Intergenic
1087057010 11:93946575-93946597 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1087157262 11:94917582-94917604 CAGCTTAGGCAGATGGGGTCTGG - Intergenic
1087197751 11:95317678-95317700 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1087312062 11:96556290-96556312 CTGCTCAGGGTTCAGGGGTCAGG - Intergenic
1087713628 11:101583007-101583029 GAGCGCAGGATGAAGGGGTCTGG + Intronic
1087820285 11:102704042-102704064 CATCTCAAGGAAAAGGGGGCAGG - Intronic
1087859960 11:103141637-103141659 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1087948838 11:104195133-104195155 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1088302523 11:108374196-108374218 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1088527612 11:110773726-110773748 GAGCTCAGGTAGATGGGATCTGG + Intergenic
1088642517 11:111887115-111887137 GAGCTGAGGGAGTGGGGGTCGGG - Intergenic
1088731079 11:112683854-112683876 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1088976246 11:114818674-114818696 AAGCTCAGGGTTAAGGGGCCTGG - Intergenic
1089148937 11:116349934-116349956 CAGCTCATGGGGCTGGGGTCTGG + Intergenic
1089420624 11:118330773-118330795 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1089567958 11:119382002-119382024 CAGCCCAGTGAGAAGGGGAGTGG - Intergenic
1089585393 11:119507477-119507499 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1089587093 11:119516855-119516877 TTGCTTGGGGAGAAGGGGTCGGG - Intergenic
1089587523 11:119519874-119519896 CAGCTCAGGGTTCAGGGCTCAGG + Intergenic
1089884338 11:121804965-121804987 AAACTCAGGAAGAAGGAGTCAGG + Intergenic
1090181651 11:124704836-124704858 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1090323421 11:125864177-125864199 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1090412972 11:126521481-126521503 CAGGTCAGGGAGCTGGGGTGGGG + Intronic
1090546806 11:127774602-127774624 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1091443706 12:530999-531021 GTGCTCTGGGAGAAGAGGTCTGG + Intronic
1091549975 12:1530073-1530095 CGGCGCCGGGAGAAGGGGGCCGG + Intronic
1091586218 12:1818277-1818299 CAGCTCATTGAGAACGGGCCAGG + Intronic
1091627670 12:2135613-2135635 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1091762232 12:3095358-3095380 CAGCTCATTGAGAACGGGCCAGG - Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092290838 12:7158673-7158695 CAGGTCACGGAGGAGGGGCCGGG - Exonic
1092416468 12:8293843-8293865 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1092591273 12:9953716-9953738 CAGCTCATTGAGAACGGGCCAGG + Intronic
1092593044 12:9968371-9968393 CAGCGAAGGGAGATGGGGTGGGG + Intronic
1092676887 12:10930558-10930580 CAGGTCAGGGAGAGAGGGGCCGG + Intronic
1092706535 12:11290931-11290953 CTGCTCAGGGTTCAGGGGTCAGG - Intergenic
1093493892 12:19734116-19734138 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1093571283 12:20668534-20668556 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1093605898 12:21087892-21087914 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1093615195 12:21214368-21214390 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1093951655 12:25169393-25169415 CAGCGAAGGGAGATGGGGTAGGG - Intronic
1094092864 12:26670257-26670279 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1094209505 12:27874368-27874390 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1094282991 12:28760926-28760948 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
1094377878 12:29810425-29810447 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
1094518882 12:31163771-31163793 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1094520371 12:31180731-31180753 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1094670227 12:32562901-32562923 CAGCTCATTGAGAACGGGCCGGG - Intronic
1094735391 12:33228267-33228289 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
1095065087 12:37762400-37762422 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1095068449 12:37814198-37814220 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1095340806 12:41086764-41086786 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1095423367 12:42048922-42048944 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1095591349 12:43907181-43907203 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1095955454 12:47803202-47803224 CAGTTCAGGGTCAAGGGGACAGG + Intronic
1095966472 12:47870464-47870486 CAGCTCAGGAAGGGGGGGTAGGG + Intronic
1096020971 12:48325475-48325497 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1096021879 12:48332189-48332211 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1096039238 12:48500212-48500234 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1096092931 12:48915599-48915621 CAGCTCATTGAGAACGGGCCAGG - Intronic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1096856468 12:54487969-54487991 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1096892844 12:54789269-54789291 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1096922384 12:55101563-55101585 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1096931127 12:55211124-55211146 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1097028399 12:56075583-56075605 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1097124888 12:56766190-56766212 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1097409034 12:59227755-59227777 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1097455762 12:59796547-59796569 CCAGTCAGGGAGCAGGGGTCTGG - Intergenic
1098062626 12:66578967-66578989 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1098294660 12:68991733-68991755 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1098402074 12:70086533-70086555 CAGCACAGAGATAAGAGGTCAGG - Intergenic
1098464000 12:70765720-70765742 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1098654163 12:73007418-73007440 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1098668837 12:73199069-73199091 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1098794817 12:74875571-74875593 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1099041027 12:77654664-77654686 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1099106823 12:78507130-78507152 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1099235656 12:80080106-80080128 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1099361439 12:81706665-81706687 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1099750311 12:86764573-86764595 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1099872651 12:88368962-88368984 CAGCTTGGGGAGAAGGGGAGAGG - Intergenic
1099999064 12:89811882-89811904 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1100582543 12:95948637-95948659 CAGCTCATTGAGAACGGGCCAGG + Intronic
1100753477 12:97724536-97724558 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1100845631 12:98655317-98655339 CAGCTCATTGAGAACGGGCCAGG - Intronic
1100984007 12:100187980-100188002 GAGCCCAGGGTGAAGGGGTGGGG - Intergenic
1100994887 12:100294016-100294038 CAGCTCATTGAGAACGGGCCAGG - Intronic
1101393309 12:104323291-104323313 CAGCTCATTGAGAACGGGCCAGG - Intronic
1102174536 12:110866806-110866828 CAGCTCATTGAGAACGGGCCAGG - Intronic
1102176815 12:110882099-110882121 CAGCACAGGGAGAAGGTGTGTGG + Intronic
1102293775 12:111722873-111722895 CAGCTCATTGAGAACGGGCCAGG - Intronic
1102400204 12:112621893-112621915 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1102578874 12:113873186-113873208 CAGCTCATTGAGAACGGGCCAGG + Intronic
1102586717 12:113928666-113928688 CAGCTCAGGGAGTTGGGAACAGG + Intronic
1102815103 12:115859077-115859099 CAGCACAGGGAGTGTGGGTCGGG + Intergenic
1103234350 12:119360021-119360043 CAGCTCATTGAGAACGGGCCAGG - Intronic
1103299626 12:119918293-119918315 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1103591571 12:121994464-121994486 CAGCTCATTGAGAACGGGCCAGG + Intronic
1103930715 12:124449442-124449464 CGGCTCAGGGAGATGGGGAGTGG - Intronic
1103982242 12:124744129-124744151 CAGCTCAGTGAGGCGAGGTCAGG + Intergenic
1104712404 12:130996264-130996286 CAGCTCATTGAGAACGGGCCAGG - Intronic
1105338557 13:19497485-19497507 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1105368190 13:19780318-19780340 CAGCTCATTGAGAACGGGCCAGG + Intronic
1105556225 13:21448724-21448746 CAGCTCATTGAGAACGGGCCAGG + Intronic
1106223827 13:27770347-27770369 CAGCTCTGAGAGAAGGGCTTAGG + Intergenic
1106680304 13:32000630-32000652 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1106885672 13:34181632-34181654 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1106918938 13:34541475-34541497 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1107005490 13:35604911-35604933 CAGCTGAGGAAGAAGGGAGCAGG - Intronic
1107227263 13:38066074-38066096 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1107692549 13:42966785-42966807 CAGCTCATTGAGAACGGGCCAGG + Intronic
1108024479 13:46163144-46163166 CAGCTCATTGAGAACGGGCCAGG + Intronic
1108059091 13:46515382-46515404 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1108330666 13:49379202-49379224 CAGCTCATTGAGAACGGGCCAGG + Intronic
1108341856 13:49504721-49504743 CAGCTCATTGAGAACGGGCCAGG + Intronic
1108351651 13:49593730-49593752 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1108607529 13:52054634-52054656 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1108608892 13:52064628-52064650 CAGCTCATTGAGAACGGGCCGGG + Intronic
1108628368 13:52255014-52255036 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1108657691 13:52551435-52551457 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1108703920 13:52968074-52968096 GAGCTCAGAGAGTAGGGGTGGGG - Intergenic
1108832302 13:54495082-54495104 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1108952303 13:56110308-56110330 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1109270571 13:60251330-60251352 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1109422526 13:62132042-62132064 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1110086780 13:71389995-71390017 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1110269711 13:73575713-73575735 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1110275894 13:73641220-73641242 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1110353334 13:74537057-74537079 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
1110698378 13:78518666-78518688 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1111418097 13:87976098-87976120 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1111778241 13:92690873-92690895 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1112083378 13:96001426-96001448 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1112113791 13:96331487-96331509 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1112236510 13:97642590-97642612 CAGCTAAGGGAGATGGGGTGGGG - Intergenic
1112590776 13:100761998-100762020 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1112745510 13:102522720-102522742 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1113051220 13:106214238-106214260 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1113122082 13:106934643-106934665 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1113323935 13:109265397-109265419 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1113768352 13:112894345-112894367 CAGCCCTGGGAGGAGGCGTCAGG + Intergenic
1114156030 14:20104350-20104372 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1114167553 14:20235581-20235603 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1114197852 14:20494873-20494895 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1114221414 14:20701130-20701152 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1114222180 14:20706455-20706477 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1114346068 14:21796544-21796566 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1114428366 14:22639491-22639513 CAGCTCATTGAGAACGGGTCAGG + Intergenic
1114457608 14:22866718-22866740 CATCTCAGGGAGTAGGAGTTTGG - Intergenic
1114685454 14:24526647-24526669 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1114751508 14:25209843-25209865 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1114828275 14:26107109-26107131 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1114869136 14:26634579-26634601 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1114872811 14:26678626-26678648 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1115133432 14:30080568-30080590 CAGCTCAGCTACAAGGGGACTGG - Intronic
1115158267 14:30364235-30364257 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1115330432 14:32190834-32190856 GGGCTCAGGGAGAAGGGATTGGG + Intergenic
1115610003 14:35039765-35039787 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1115688804 14:35824442-35824464 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1115868221 14:37772110-37772132 CTGCTCGGGGATCAGGGGTCAGG + Intronic
1116005161 14:39285238-39285260 CAGCTCATTGAGAACGGGCCAGG - Intronic
1116199540 14:41773246-41773268 CTGCTCAGGGAGAAACAGTCAGG - Intronic
1116339120 14:43699341-43699363 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1116480826 14:45390336-45390358 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1116696789 14:48187781-48187803 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1116704397 14:48278571-48278593 CAGCGAAGGGAGACGGGGTGCGG + Intergenic
1116859164 14:49979817-49979839 CAGTTCAAGGAGACAGGGTCTGG - Intergenic
1116871767 14:50074418-50074440 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1116959595 14:50956429-50956451 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1117044524 14:51799913-51799935 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1117280378 14:54234578-54234600 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1117452190 14:55862323-55862345 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1117716721 14:58588655-58588677 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1118070303 14:62239410-62239432 CAGCTCAGGAAAAATGGTTCTGG + Intergenic
1118148884 14:63166324-63166346 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1118446911 14:65860446-65860468 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1118889284 14:69894495-69894517 CATTTCTGGGACAAGGGGTCAGG + Intronic
1119254137 14:73183785-73183807 CAGCTCATTGAGAACGGGCCAGG - Intronic
1119700485 14:76750879-76750901 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1119711053 14:76822228-76822250 CAGCTCATTGAGAACGGGCCGGG + Intronic
1120069729 14:80089226-80089248 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
1120893121 14:89506632-89506654 CAGCTCATTGAGAACGGGCCAGG + Intronic
1120971489 14:90212086-90212108 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1121142670 14:91557021-91557043 CAGCTCATTGAGAAAGGGCCGGG - Intergenic
1121306511 14:92911200-92911222 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1121479601 14:94253962-94253984 CAGCTCAGGGAGTGTGGCTCCGG - Intronic
1121495684 14:94390177-94390199 GAGCTCAGAGAGAAGGGGAGGGG - Intronic
1121926239 14:97929974-97929996 CAGCGCAGAGATAAGGGGTGGGG - Intronic
1121950031 14:98163628-98163650 CAGGGCAGGGAGGAGGGGACAGG - Intergenic
1122130421 14:99601985-99602007 CAGCTCAGGCTGAGGGGTTCTGG + Intronic
1122212472 14:100181436-100181458 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1122388108 14:101362610-101362632 CAGGTCGGGGAGAAGGTGGCCGG - Intergenic
1122861980 14:104586812-104586834 CAGCTCAGGGAGGAGGGTGTTGG + Intronic
1122963492 14:105111270-105111292 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1202883284 14_KI270722v1_random:81818-81840 CTGCTCAGGGCTCAGGGGTCAGG + Intergenic
1123882760 15:24690727-24690749 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1124152389 15:27193150-27193172 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1124245999 15:28070669-28070691 CAGCTCATTGAGAACGGGCCAGG + Intronic
1124343839 15:28908103-28908125 CAGCTCAGGGACAACGGCTCGGG - Intronic
1125079605 15:35657078-35657100 CAGCTCATTGAGAAGGGGCCAGG + Intergenic
1125218693 15:37308710-37308732 CTGCTCGGGGATCAGGGGTCAGG + Intergenic
1125226749 15:37404756-37404778 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1125228798 15:37427849-37427871 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1125387775 15:39156425-39156447 CAGCTGAGAGGGCAGGGGTCAGG + Intergenic
1125659614 15:41383541-41383563 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1126843415 15:52738864-52738886 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1127154648 15:56111154-56111176 CAGCTCATTGAGAACGGGCCAGG + Intronic
1127369933 15:58330300-58330322 CAGCTGGGGGAGAACAGGTCTGG - Intronic
1127438778 15:58985616-58985638 CAACTCAGGGAGGAGGGGCGTGG - Intronic
1127638907 15:60896945-60896967 CTGCTCAGGGAGAGATGGTCAGG + Intronic
1127782793 15:62332062-62332084 CAGCTCATTGAGAACGGGCCGGG - Intergenic
1127829523 15:62738040-62738062 CATCTCTGGGACAAGGGGCCTGG + Intronic
1128562997 15:68680916-68680938 AAGCTTAGGGAAAAGGGGCCGGG + Intronic
1128694462 15:69750140-69750162 CAGCCCAGGGAGAAGGACTTAGG - Intergenic
1128938706 15:71769423-71769445 CAGCTCATTGAGAACGGGCCAGG + Intronic
1128970662 15:72101995-72102017 CAGCTCATTGAGAACGGGCCAGG + Intronic
1129097131 15:73221360-73221382 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1129157592 15:73728458-73728480 GAGCTCAGGAACAAGGGTTCAGG - Intergenic
1129428687 15:75481964-75481986 CAGCTCATTGAGAACGGGCCAGG + Intronic
1129431874 15:75504967-75504989 CAGCTCATTGAGAACGGGCCAGG + Intronic
1129711964 15:77824986-77825008 GAGCTCATGGAGCAGGGGCCAGG + Intergenic
1129837536 15:78720530-78720552 CTGCTCGGGGATCAGGGGTCAGG - Intronic
1130197980 15:81798629-81798651 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1130340559 15:82997690-82997712 CAGCTCATTGAGAACGGGCCAGG - Intronic
1130697339 15:86143932-86143954 TAGCACAGGGAGAAAGCGTCAGG + Intronic
1130924612 15:88375658-88375680 CAGCTCAGGGGGCAGAGGGCAGG + Intergenic
1131001124 15:88941236-88941258 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1131058754 15:89391636-89391658 CAGCTCAGGGAGACAGGGAAAGG - Intergenic
1131078706 15:89515681-89515703 CAGCTCAGGGAGAGGTACTCAGG + Intergenic
1131125705 15:89855033-89855055 CAGCTCATTGAGAACGGGCCAGG + Intronic
1131127688 15:89869077-89869099 CAGCTCATTGAGAACGGGTCAGG + Intronic
1131141242 15:89978258-89978280 CAGCTCATTGAGAAGGGGCCAGG + Intergenic
1131479182 15:92767960-92767982 CAGCTCATTGAGAACGGGCCAGG - Intronic
1132036915 15:98492883-98492905 CAGCTCATTGAGAACGGGCCGGG - Intronic
1132124693 15:99212612-99212634 CAGCCCAGGGAGAAAGGCACTGG + Intronic
1132186679 15:99806946-99806968 CAGCTGAGGGAGGAAGGGGCGGG - Intergenic
1132222518 15:100115557-100115579 CAGCTCAAAGAGGATGGGTCAGG + Intronic
1132254738 15:100365966-100365988 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1132416942 15:101627146-101627168 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1132429008 15:101745765-101745787 CAGCTGAGGGAGGAAGGGGCGGG + Intergenic
1132646048 16:999796-999818 CAGCTCAGCCAGCAGGGGCCAGG + Intergenic
1132647912 16:1007553-1007575 CAGCTCAGGGAAAAGGGTGTGGG + Intergenic
1132777048 16:1599959-1599981 CAGCTCATTGAGAACGGGCCAGG + Intronic
1132926028 16:2429531-2429553 CAGGGCAGGCAGAAGGGGTGTGG - Intronic
1132974710 16:2705533-2705555 AGGCTCAGGGCCAAGGGGTCAGG + Intronic
1133387920 16:5385705-5385727 CTGCTCAGGGAGAAGTGAGCAGG + Intergenic
1133659558 16:7903242-7903264 CAGCTCATTGAGAACGGGCCGGG - Intergenic
1133751923 16:8732709-8732731 CAGCTCATTGAGAACGGGCCAGG - Intronic
1134004228 16:10807107-10807129 AAGCTCAGGGGACAGGGGTCTGG + Intronic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1134184676 16:12075597-12075619 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1135026601 16:19003538-19003560 CAGCTCATTGAGAACGGGCCAGG + Intronic
1135639498 16:24108840-24108862 CAGCTCATTGAGAACGGGCCAGG - Intronic
1136058677 16:27709727-27709749 CAGCTTAGGGAGAGAGTGTCTGG - Intronic
1136100801 16:27994252-27994274 CAGCTCATGGAGGATGGGGCTGG + Intronic
1136160831 16:28417323-28417345 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1136197653 16:28665947-28665969 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1136202135 16:28697677-28697699 CAGCTCATTGAGAACGGGCCAGG - Intronic
1136381510 16:29898189-29898211 CAGCCCAGGGAGAAGGGAGAGGG - Intronic
1136426412 16:30170419-30170441 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1136547062 16:30961093-30961115 GAATTCAGGGAAAAGGGGTCAGG + Intronic
1136983084 16:35075609-35075631 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1137221339 16:46454711-46454733 CTGCTCGGGGATCAGGGGTCCGG + Intergenic
1137244842 16:46694347-46694369 CAGCTCATTGAGAACGGGCCAGG - Intronic
1137284089 16:47000797-47000819 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1138258997 16:55599481-55599503 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1138400127 16:56739203-56739225 CAGCTCATTGAGAACGGGCCAGG - Intronic
1138528952 16:57624729-57624751 CAGGACAGGGATAAGGGGTTAGG - Intronic
1138626980 16:58260229-58260251 CATGAGAGGGAGAAGGGGTCAGG + Intronic
1138642078 16:58395819-58395841 CAGCTCATTGAGAACGGGCCAGG - Intronic
1138658020 16:58501755-58501777 CACCTCAGGGGGATGGGGACAGG + Intronic
1138940392 16:61782774-61782796 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1139052927 16:63147843-63147865 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1139237747 16:65357419-65357441 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1139271835 16:65690697-65690719 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
1139476126 16:67203374-67203396 CATGTCCGGGAGAAGGGCTCCGG + Exonic
1139585947 16:67903716-67903738 CAGCTCAGCGGCAAGTGGTCAGG - Intronic
1139844379 16:69909229-69909251 AAGTTCAAGGAGAAGGGGTTTGG + Intronic
1139885744 16:70205460-70205482 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1139953364 16:70682269-70682291 CAGCTCAGGGTGAAGGGGCCTGG + Intronic
1140076919 16:71708451-71708473 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1140559408 16:75960583-75960605 AATGTCAAGGAGAAGGGGTCAGG - Intergenic
1140943955 16:79749833-79749855 CAGCCCAGGAGGAAGGGGACTGG - Intergenic
1141636199 16:85315200-85315222 TGGCTGAGGGAGCAGGGGTCGGG + Intergenic
1141810273 16:86371343-86371365 CGGCTCAGGGAGCAAGGGTGAGG - Intergenic
1142120984 16:88386557-88386579 GAGCCCGGGGAGAAGGGATCCGG - Intergenic
1142157495 16:88539291-88539313 CAGCTCAGGTAGAAGGGAGCAGG - Intergenic
1142704918 17:1689063-1689085 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1142812048 17:2399974-2399996 CAGCTCTGGGAGGCGGGGTCAGG + Intronic
1143018423 17:3904077-3904099 GAGCTCCTGGAGAAGGGGTCTGG - Intronic
1143115219 17:4578295-4578317 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1143277243 17:5721333-5721355 CAGCTCATTGAGAATGGGCCGGG - Intergenic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1143342856 17:6226585-6226607 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1143921278 17:10332701-10332723 CAGCTCAGTGGGGAGGGGTGTGG + Intronic
1144092006 17:11866451-11866473 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1144482238 17:15637754-15637776 CAGCTCATTGAGAACGGGCCAGG + Intronic
1144621435 17:16821079-16821101 CAGCTCAGGAAGGAGGGCTAGGG - Intergenic
1144703575 17:17353489-17353511 CAGGACAGGCAGAAAGGGTCAGG + Intergenic
1144714450 17:17424355-17424377 CAGCTGAGGCAGCAGGGGACTGG - Intergenic
1144716812 17:17442147-17442169 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1144854925 17:18262405-18262427 CAGCTTTGGGAGAAGGGGCTTGG + Intronic
1144934636 17:18888334-18888356 CAGCTCATTGAGAACGGGCCAGG - Intronic
1145047085 17:19627611-19627633 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1145206321 17:20985705-20985727 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1145684647 17:26639353-26639375 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1145717353 17:27034332-27034354 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1145731251 17:27188360-27188382 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1145863206 17:28224785-28224807 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1145895566 17:28455898-28455920 CAGCTCATTGAGAACGGGCCAGG - Intronic
1147024282 17:37566141-37566163 CCGCTCATTGAGAAGGGGCCAGG + Intronic
1147109803 17:38253527-38253549 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1147559526 17:41500370-41500392 GAGCACAGAGAGAAGGGGCCAGG + Intergenic
1147573413 17:41585393-41585415 CAGCTCAGGAAGGAGGGCTAGGG - Intronic
1147785219 17:42973500-42973522 CAGCTCACTGAGAACGGGCCAGG + Intronic
1147911342 17:43858034-43858056 CAGCAGAGGGAGGAGGGGCCAGG - Intronic
1147963671 17:44181333-44181355 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1148267459 17:46238066-46238088 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1148441936 17:47715975-47715997 CAGCGCAGGGGGCAGGGGTGGGG + Intergenic
1148953154 17:51332375-51332397 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1149320496 17:55476396-55476418 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1149567972 17:57652972-57652994 CAGTTCAGGGAGCAGGGGTGGGG - Intronic
1149793764 17:59500656-59500678 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1150380665 17:64716857-64716879 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1150557860 17:66269478-66269500 CAGCTCATTGAGAACGGGTCAGG + Intergenic
1151083672 17:71357256-71357278 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1151120849 17:71791207-71791229 CACTTCAGGGAGAAGGGCTGAGG - Intergenic
1151155068 17:72118314-72118336 CAGGTCAGGGAGGAGGGGTCGGG + Intergenic
1151383975 17:73744035-73744057 GGGCTCAGGGAGCAGGTGTCTGG + Intergenic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1151994022 17:77597354-77597376 CAGCTCAGGGAGGAGCAGTCAGG - Intergenic
1152075772 17:78158752-78158774 CTGCTCGGGGAGAAGGGGGTGGG + Intronic
1152207327 17:78981123-78981145 CATCTCTGGGAGTAGGGGACAGG + Intergenic
1152456897 17:80421927-80421949 CAGCTGCGGGAGAAGGAGCCGGG + Exonic
1152487163 17:80602055-80602077 CAGCTCATTGAGAACGGGCCAGG - Intronic
1152514949 17:80817628-80817650 CAGGTCCGGGAGAAGGGGTGGGG + Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152593964 17:81229281-81229303 CAGATGAGGGAGCAGGGCTCCGG + Exonic
1203191292 17_KI270729v1_random:192050-192072 CTGCTCAGGGTTCAGGGGTCAGG - Intergenic
1153010754 18:536398-536420 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1153164663 18:2247870-2247892 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1153545894 18:6204374-6204396 CAGCTGTGGGAGAAGGGGTGGGG - Intronic
1154398088 18:14010445-14010467 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1155330970 18:24716126-24716148 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1156292586 18:35761010-35761032 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1156302836 18:35850303-35850325 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1156566180 18:38193846-38193868 AAGCTAAGGGAGAAAGAGTCAGG + Intergenic
1156679009 18:39566291-39566313 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1156939191 18:42744179-42744201 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1156957977 18:42991836-42991858 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1157009592 18:43630484-43630506 GAGCTCAGGAAGGAGGAGTCAGG + Intergenic
1157039696 18:44024109-44024131 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1157324147 18:46657098-46657120 GAGCTCAGGGAGGAGGTCTCAGG - Intergenic
1157612969 18:48970056-48970078 CAGCTGAGGGAGAAGGAATGAGG - Intergenic
1157629143 18:49079892-49079914 CAGCTCATTGAGAACGGGCCGGG - Intronic
1157640062 18:49203360-49203382 CAGCTCATTGAGAACGGGCCAGG + Intronic
1157677135 18:49577505-49577527 CAGCTCATTGAGAACGGGCCAGG - Intronic
1157896152 18:51470288-51470310 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1158148895 18:54344080-54344102 CAGCTCATTGAGAACGGGCCAGG + Intronic
1158177109 18:54669614-54669636 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1158664564 18:59420837-59420859 CAGCTGTGGGAGAAGAGGACCGG - Intergenic
1158695229 18:59697470-59697492 CTGCACGGGGAGCAGGGGTCCGG + Intergenic
1158710049 18:59829560-59829582 CAGCACAGGGATAAGGGATGAGG + Intergenic
1158868961 18:61665752-61665774 CATCTGAGGGAGAAGGGGGAAGG - Intergenic
1159157981 18:64608815-64608837 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1159164964 18:64687200-64687222 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1159340365 18:67126674-67126696 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1159466485 18:68790136-68790158 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1159834704 18:73324922-73324944 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1160005072 18:75063498-75063520 CTGCTCGGGGAGGATGGGTCCGG - Exonic
1160483780 18:79269159-79269181 CTGCTCTGGGACATGGGGTCAGG + Intronic
1160804790 19:987800-987822 CGGCTAGGGGAGCAGGGGTCTGG - Intronic
1160878397 19:1308499-1308521 CAGCCCAGGGAGAATGAGGCTGG + Intergenic
1161406760 19:4095225-4095247 CAGCTCTGGGAAAAGGAATCTGG + Intronic
1161592566 19:5135424-5135446 CATCTCAGGGATGAGCGGTCGGG - Exonic
1161827355 19:6577174-6577196 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1161908465 19:7175137-7175159 CATCTCAGGCAGAAAGGGCCGGG - Intronic
1162172340 19:8801277-8801299 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1162542076 19:11303063-11303085 CAGCTCATTGAGAACGGGCCAGG + Intronic
1162714572 19:12621862-12621884 CAGCTCATTGAGAACGGGCCAGG + Intronic
1162789531 19:13055676-13055698 TAGCTGAGGAAGAAGGGGGCGGG + Intronic
1162856954 19:13476096-13476118 CAGCTCAGGAAGCTGGGGCCAGG + Intronic
1162887147 19:13704033-13704055 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1163019579 19:14475150-14475172 CAGATCAGGGAGAAGAGCCCGGG + Intronic
1163636090 19:18437792-18437814 CGGCTCGGGGAGAAGGGCACGGG - Intronic
1163687058 19:18717683-18717705 CAGCTCAGAGAGGAGGGTGCAGG + Intronic
1163769454 19:19182062-19182084 CAGCTGGGGGAGATGGGGCCAGG - Intronic
1163904367 19:20138115-20138137 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1163905548 19:20149261-20149283 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1164081467 19:21865233-21865255 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1164105545 19:22106596-22106618 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1164192947 19:22928093-22928115 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1164440123 19:28270406-28270428 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1164594821 19:29526022-29526044 CAGCGCGGGGAGAGCGGGTCCGG - Intergenic
1164652153 19:29898827-29898849 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1164968692 19:32510851-32510873 CAGCCCAGGGGGAGGGAGTCAGG + Intergenic
1165192736 19:34078976-34078998 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1165391535 19:35541985-35542007 CAGCATATGGAGAAAGGGTCTGG + Intronic
1166028114 19:40107704-40107726 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1166030156 19:40118872-40118894 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1166192059 19:41181331-41181353 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1166261836 19:41645364-41645386 CAGCTCATTGAGAACGGGCCAGG + Intronic
1166417872 19:42610153-42610175 CAGCTCATTGAGAACGGGCCGGG - Intronic
1166429808 19:42714989-42715011 CTGCTCGGGGATCAGGGGTCAGG - Intronic
1166714235 19:44956227-44956249 CAGCTCAGGGGAAAGGAGTGCGG + Intronic
1167038881 19:47010118-47010140 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1167596884 19:50432645-50432667 AATCTCAGGGAGGAGGGGACTGG - Intergenic
1167681918 19:50928800-50928822 CAGCTCAGGGAGACAGAGTCAGG - Intergenic
1167792386 19:51690149-51690171 GATCTGAGGGAGGAGGGGTCTGG - Intergenic
1167902617 19:52633272-52633294 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1167907840 19:52676633-52676655 CAGCTCATTGAGAACGGGCCAGG + Intronic
1167980240 19:53269875-53269897 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1168095902 19:54114779-54114801 GATCTCAGGGAGGAGGGGTTGGG - Intronic
1168308515 19:55449697-55449719 CAGCTGAGGGGGAAGGGGCCCGG + Intergenic
1168558514 19:57363739-57363761 CAGCACTGGAAGGAGGGGTCGGG - Exonic
1168567273 19:57435621-57435643 CAGCACTGGGAGGAGGGGTTGGG - Intronic
1168572780 19:57483723-57483745 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1202658696 1_KI270708v1_random:48962-48984 CTGCTCAGGGCTCAGGGGTCAGG + Intergenic
925589225 2:5493498-5493520 CAAGTGAGGGAGAAGGGGGCCGG - Intergenic
925598973 2:5588707-5588729 CAGCTCTGGGAGAAGGCTACTGG - Intergenic
925810607 2:7696678-7696700 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
926156008 2:10454397-10454419 CAGCCGAGGGAGCAGGGGCCTGG + Intergenic
926215252 2:10902437-10902459 CAGCTCATTGAGAACGGGCCAGG - Intergenic
926226681 2:10971790-10971812 GAGCTCAGGGAAGAGGGGACAGG + Intergenic
926230633 2:11001416-11001438 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
926403715 2:12527056-12527078 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
926408237 2:12575314-12575336 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
926507831 2:13738567-13738589 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
926601348 2:14848762-14848784 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
926704426 2:15826615-15826637 CAGCCCAGGGAGAGGTGGACAGG + Intergenic
927354455 2:22157142-22157164 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
927747485 2:25634563-25634585 CAGCTCATTGAGAACGGGCCAGG + Intronic
927757742 2:25723112-25723134 CAGCTCAATGAGAACGGGCCAGG - Intergenic
927832999 2:26370346-26370368 CAGCTCATTGAGAACGGGCCAGG - Intronic
927978816 2:27359746-27359768 CAGCTCATTGAGAACGGGCCAGG + Intergenic
928168539 2:28988461-28988483 CAGCTGAGGGAGAAGGGCACAGG - Intronic
928390377 2:30904896-30904918 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
928597519 2:32870039-32870061 CAGCTCATTGAGAACGGGCCAGG + Intergenic
928935624 2:36674576-36674598 TGGCTTGGGGAGAAGGGGTCGGG - Intergenic
929004347 2:37381116-37381138 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
929416569 2:41748203-41748225 CAGCTCATTGAGAACGGGCCAGG + Intergenic
929447632 2:42014218-42014240 CAGCTCATTGAGAACGGGCCAGG - Intergenic
929515752 2:42605071-42605093 CAGCTCATTGAGAACGGGCCAGG - Intronic
929614825 2:43298104-43298126 CAGCTCATTGAGAACGGGCCAGG + Intronic
929638290 2:43548299-43548321 CTGCTCAGGGTTCAGGGGTCAGG + Intronic
930113429 2:47698380-47698402 CAGCGAAGGGAGATGGGGTGGGG + Intronic
930201439 2:48555214-48555236 CAGCTCATTGAGAACGGGCCAGG - Intronic
930220416 2:48740527-48740549 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
930704046 2:54486227-54486249 CAGCTCATTGAGAACGGGCCAGG + Intronic
930751806 2:54941796-54941818 CAGCTTCGAGAGAAGGGCTCTGG - Intronic
930833746 2:55773422-55773444 CAGCTCATTGAGAACGGGCCAGG - Intergenic
930954670 2:57192608-57192630 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
930954784 2:57193371-57193393 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
931048745 2:58386846-58386868 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
931509503 2:62975247-62975269 CAGCTTAGGCAGAAAGGGTATGG + Intronic
931576536 2:63722791-63722813 CAGCTCATTGAGAACGGGCCAGG + Intronic
931655902 2:64511436-64511458 CAGCTCATTGAGAACGGGCCAGG - Intergenic
931668176 2:64624955-64624977 GTGCTCAGGGAGATGGGGCCGGG - Intergenic
931818605 2:65929621-65929643 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
931840578 2:66144249-66144271 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
931950548 2:67356766-67356788 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
932367406 2:71161586-71161608 CAGCTCATTGAGAACGGGCCGGG + Intergenic
932471538 2:71962623-71962645 CAGCTCAGGGAGGAGGAGTGTGG - Intergenic
932644252 2:73485381-73485403 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
932672989 2:73754282-73754304 CATCACAGGGAGACAGGGTCAGG - Intergenic
932955869 2:76350607-76350629 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
932980072 2:76653302-76653324 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
933780242 2:85796033-85796055 CAGCTGAGGCAGAATGGGCCAGG - Intergenic
933781127 2:85802142-85802164 CAGCTCAGGGGGAAGAGAGCTGG - Intergenic
934309909 2:91852491-91852513 CAGCTCATTGAGAACGGGCCAGG + Intergenic
934701150 2:96441278-96441300 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
934703886 2:96462608-96462630 CAGCTCATTGAGAACGGGCCAGG + Intergenic
934752951 2:96805935-96805957 CAGCTCATTGAGAACGGGCCAGG - Intronic
935631196 2:105213773-105213795 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
936036476 2:109117065-109117087 CTGCTCAGGGATCAGGGGTCAGG + Intergenic
936387119 2:112040552-112040574 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
936505517 2:113102630-113102652 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
936546636 2:113395511-113395533 CAGCTCATTGAGAACGGGCCAGG + Intergenic
936985812 2:118310614-118310636 CAGCGCAGGAAGAAGGGGTGAGG + Intergenic
937045603 2:118849666-118849688 CATTTCGGGGAGAAGGGGTGGGG - Intergenic
937168351 2:119843477-119843499 CAGCTCATTGAGAACGGGCCAGG - Intronic
937246551 2:120497592-120497614 CAGCTCAGGGAGGTGGTGTCAGG + Intergenic
937276852 2:120690459-120690481 GAGGTCAGGGAGGAGGGGACGGG + Intergenic
937432568 2:121851741-121851763 CAGCTCTGGGAGAACGTGGCAGG - Intergenic
937437764 2:121893279-121893301 CAGCTCACTGAGAACGGGCCAGG + Intergenic
937861912 2:126718089-126718111 AAGATCAGGGAGAAGTGTTCTGG - Intergenic
937919313 2:127119388-127119410 CAGCTCATTGAGAACGGGCCAGG - Intergenic
938005509 2:127787345-127787367 CAGCTCATTGAGAACGGGCCAGG - Intronic
938704542 2:133911179-133911201 CTGCTCGGGGGGCAGGGGTCAGG - Intergenic
938808203 2:134826144-134826166 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
939239327 2:139538253-139538275 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
939461003 2:142495039-142495061 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
939519810 2:143215540-143215562 CAGCTCAGGGAGAAGGGTGTGGG + Intronic
939777688 2:146406438-146406460 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
939788006 2:146540170-146540192 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
940085228 2:149851143-149851165 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
940107873 2:150118442-150118464 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
940508203 2:154582740-154582762 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
940820681 2:158351911-158351933 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
941025825 2:160455211-160455233 CAGCTCAGGTAGAAAAGGCCAGG - Intronic
941053559 2:160762355-160762377 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
941545513 2:166845666-166845688 AATCTGAGGGAGAAGGGGTATGG + Intergenic
941769340 2:169328417-169328439 CAGCTCATTGAGAACGGGCCGGG + Intronic
941814362 2:169785514-169785536 CAGCTCATTGAGAACGGGCCAGG - Intergenic
942021397 2:171869702-171869724 CAACTCAAGGAGAAGGGCTTTGG - Intronic
942096420 2:172538568-172538590 CAGCTCATTGAGAACGGGCCAGG + Intergenic
942126317 2:172828998-172829020 CAGCTCAGGGAACAGGGATCAGG + Intronic
942520372 2:176797117-176797139 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
942615377 2:177786096-177786118 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
942620955 2:177845026-177845048 CAGCTCATTGAGAACGGGCCAGG - Intronic
942630871 2:177947273-177947295 CAGCTCATTGAGAACGGGCCAGG + Intronic
942685875 2:178531447-178531469 CAGCTCAGGGAAAACAGATCTGG + Exonic
943109417 2:183586892-183586914 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
943130729 2:183850218-183850240 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
943297031 2:186153818-186153840 CAGCTCACTGAGAACGGGCCAGG - Intergenic
943873962 2:193037813-193037835 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
944257601 2:197640045-197640067 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
944262484 2:197692845-197692867 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
944264578 2:197709425-197709447 CAGCGAAGGGAGATGGGGTGGGG + Intronic
944283212 2:197922500-197922522 CAGCTCATTGAGAACGGGCCAGG - Intronic
944625178 2:201563003-201563025 CAGCTCATTGAGAACGGGCCAGG - Intronic
944732831 2:202534748-202534770 CAGCTCATTGAGAACGGGCCAGG - Intronic
944815475 2:203372416-203372438 CAGCTCATTGAGAACGGGCCGGG - Intronic
944857034 2:203777893-203777915 CATCTCAGGGGGCAGGGGGCAGG + Intergenic
944875642 2:203962043-203962065 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
944876464 2:203967377-203967399 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
944906794 2:204269816-204269838 GAGCCCAGGGAGCAGGTGTCTGG - Intergenic
944971301 2:204996387-204996409 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
944975285 2:205042820-205042842 CAGGACAGGGAGAAGGGATGAGG - Intronic
945114760 2:206400497-206400519 CAGCTCATTGAGAACGGGCCAGG - Intergenic
946177570 2:217930842-217930864 TAGGTCAGGGAGAAGGGGTGGGG - Intronic
946302312 2:218831424-218831446 GTGTTCAGGGAGAAGGGGTTTGG - Intronic
946344288 2:219095679-219095701 TAGTTCAGGGAGGAGGGGTATGG + Intronic
946444680 2:219728162-219728184 TAGCTCAGGGAGCAGGGGAAGGG - Intergenic
946742901 2:222817099-222817121 CAGCTCATTGAGAACGGGCCAGG + Intergenic
946886978 2:224230865-224230887 CAGCGAAGGGAGATGGGGTAGGG - Intergenic
947262062 2:228234353-228234375 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
947308717 2:228776780-228776802 CAGGTCAGGGAGAAGGGCACTGG + Intergenic
947901237 2:233724018-233724040 CAGCTCATTGAGAACGGGCCAGG - Intronic
948029046 2:234801351-234801373 CAGAGCAGGGAGGATGGGTCTGG + Intergenic
948039604 2:234889087-234889109 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
948315154 2:237022871-237022893 CTCCTCTGGGAGAAGGGGTTGGG + Intergenic
948879933 2:240851489-240851511 CAGCTCAGGGGGGACGGGTCTGG - Intergenic
1168839661 20:901475-901497 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1168971228 20:1932288-1932310 CAGATCAAGGAGGTGGGGTCTGG + Intronic
1169009258 20:2236691-2236713 CTGCGCAGGGAGATGGGGGCCGG + Intergenic
1169021850 20:2336227-2336249 CAGCCCAGGGTGAAGGGTGCTGG + Intronic
1169063527 20:2679014-2679036 CAGCCCAGGAAAGAGGGGTCAGG - Intergenic
1169075895 20:2759643-2759665 CAGCTCAGGGAGAAGTGACCTGG + Exonic
1169371039 20:5028160-5028182 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1169718374 20:8644834-8644856 CAGCTCATTGAGAACGGGCCAGG + Intronic
1170097502 20:12662845-12662867 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1170424669 20:16227025-16227047 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1170504241 20:17008374-17008396 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1170515015 20:17120218-17120240 CCGCTCAGGGGTCAGGGGTCAGG + Intergenic
1170569539 20:17625103-17625125 CGGCTCTGTGAGAAGGGGGCAGG + Intronic
1170622874 20:18010077-18010099 CAGCTCATTGAGAACGGGCCGGG - Intronic
1170811413 20:19678195-19678217 CAGCTCATTGAGAACGGGCCAGG - Intronic
1171167022 20:22981053-22981075 CAGCTCAGTGGGGAGGGTTCCGG - Intergenic
1171956778 20:31469936-31469958 CAGCTCATTGAGAACGGGCCGGG - Intronic
1172059594 20:32177428-32177450 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1172141389 20:32724447-32724469 CAGCTCATTGAGAACGGGCCAGG + Intronic
1172199703 20:33115967-33115989 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1172257920 20:33536157-33536179 CAGCTCATTGAGAATGGGCCGGG - Intronic
1172348671 20:34223725-34223747 CAGCTCATTGAGAACGGGCCAGG + Intronic
1172349188 20:34229072-34229094 CAGCTCATTGAGAACGGGCCAGG - Intronic
1172402269 20:34659558-34659580 CAGCTCATTGAGAACGGGCCAGG + Intronic
1172465946 20:35154554-35154576 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1172729020 20:37069976-37069998 CAGCTCATTGAGAACGGGCCAGG + Intronic
1172736082 20:37126641-37126663 CAGCTCATTGAGAACGGGCCAGG + Intronic
1172948558 20:38706885-38706907 AAGGTGAGGGAGAAGGGTTCAGG - Intergenic
1173091458 20:39975972-39975994 CAGCCCAGGGGGAAAGGGCCAGG + Intergenic
1173426796 20:42950219-42950241 CAGCTCTGTGAGAAGGCGTGGGG - Intronic
1174100859 20:48125217-48125239 CAACACAGGGAGGAGAGGTCTGG - Intergenic
1175222971 20:57428000-57428022 CAGCTCAGGAGGAAGATGTCAGG + Intergenic
1175361111 20:58413633-58413655 CAGCTCATTGAGAACGGGCCAGG - Intronic
1175512139 20:59537083-59537105 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1175841728 20:62032263-62032285 TAGCTCAGGGAGCAGGAGTTCGG - Intronic
1176759822 21:10770451-10770473 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1176932440 21:14829564-14829586 CAGCTCTGGGAGAAGGGTTGTGG - Intergenic
1177134076 21:17291998-17292020 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1177177865 21:17719132-17719154 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1178074928 21:29006094-29006116 CAGGTAAGGGAGAAGGGGGTTGG + Exonic
1178307001 21:31499205-31499227 CACCCCAGGGAGATGGGGTGAGG - Intronic
1179265319 21:39797814-39797836 CAGCAAAGGAAGTAGGGGTCAGG - Intronic
1179557386 21:42188521-42188543 TAGCCCAGGGAGAAGGGGGCTGG + Intergenic
1180377788 22:12111245-12111267 CTGCTCAGGGGTCAGGGGTCTGG + Intergenic
1180834071 22:18921092-18921114 CACCACAAGGAGAGGGGGTCTGG - Intronic
1180952814 22:19728379-19728401 GAGCCCTGGCAGAAGGGGTCTGG - Intergenic
1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG + Intergenic
1181266855 22:21635511-21635533 GAGCTCAGGGAGAAGGTAGCAGG - Intronic
1181981842 22:26772636-26772658 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1182072761 22:27475188-27475210 AAGCTCAGGGAGAAGGAGGCTGG + Intergenic
1182343487 22:29643778-29643800 CAGCTCATTGAGAACGGGCCAGG - Intronic
1182893009 22:33834560-33834582 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1182976124 22:34625763-34625785 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1183186496 22:36294455-36294477 CAGCTAAGAGAGAAGAGGACAGG - Intronic
1183361990 22:37387633-37387655 CAGCCCAGGAAGAAGGTGGCAGG - Intronic
1183511960 22:38241161-38241183 CAGCACAGGGAGAAGGCACCAGG + Intronic
1183535049 22:38396640-38396662 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1183595608 22:38808045-38808067 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1183773611 22:39947927-39947949 GAGGTCAGGCAGAGGGGGTCTGG - Intronic
1183840953 22:40500881-40500903 CAGCTCATTGAGAATGGGCCAGG - Intronic
1183845710 22:40538074-40538096 CAGCTCATTGAGAACGGGCCAGG + Intronic
1184912745 22:47547238-47547260 CAGCTCAGGGAGAAGATGACAGG - Intergenic
1185184001 22:49381711-49381733 CAGCTCAGGGCTCAGGGCTCGGG + Intergenic
1203284159 22_KI270734v1_random:146390-146412 CACCACAAGGAGAGGGGGTCTGG - Intergenic
949592471 3:5508821-5508843 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
950044214 3:9939820-9939842 CAGCTCATTGAGAACGGGCCAGG - Intronic
950203310 3:11059800-11059822 CAGCTCAGGGAGGAAGGTGCAGG + Intergenic
950253542 3:11487322-11487344 CAGCTCATTGAGAACGGGCCAGG - Intronic
950503164 3:13377129-13377151 CAGCTTGGGGAAAAGGGGGCGGG + Intronic
950620874 3:14204259-14204281 CACCTCAGGAAGAAGGGCTGAGG + Intergenic
951013174 3:17704409-17704431 CAGCTCATTGAGAACGGGCCAGG - Intronic
951125262 3:18976638-18976660 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
951247607 3:20359180-20359202 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
951299521 3:20977006-20977028 CAGCCAAGGGAGATGGGGTGGGG + Intergenic
952330454 3:32359968-32359990 CCGCTCAGGCAGAGGGGGCCTGG - Intronic
952659153 3:35823964-35823986 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
952869482 3:37885701-37885723 TAGCAAAGGGACAAGGGGTCTGG + Intronic
952896280 3:38081303-38081325 CAGCTCATTGAGAACGGGCCAGG - Intronic
952896855 3:38083278-38083300 CAGCGAAGGGAGATGGGGTGGGG + Intronic
953133133 3:40160300-40160322 CTGCTCGGGGATCAGGGGTCAGG + Intronic
953426451 3:42798794-42798816 CAGCTCATTGAGAACGGGCCAGG + Intronic
953855310 3:46495188-46495210 CAGCTCATTGAGAACGGGCCAGG + Intergenic
954081184 3:48212586-48212608 CAGCTCATTGAGAACGGGCCAGG + Intergenic
954483444 3:50823653-50823675 CAGCTCATTGAGAATGGGCCAGG - Intronic
954523668 3:51249781-51249803 CAGCTCATTGAGAACGGGCCAGG + Intronic
955099434 3:55832315-55832337 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
955297696 3:57748265-57748287 CAGCTCATTGAGAACGGGCCAGG + Intergenic
955394599 3:58549558-58549580 CAGCTCATTGAGAACGGGCCAGG - Intergenic
955396618 3:58562295-58562317 CAGCAAAGGGAGATGGGGTGAGG - Intergenic
955434698 3:58890040-58890062 CAGCTCATTGAGAACGGGCCAGG - Intronic
955438629 3:58931481-58931503 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956242763 3:67148342-67148364 CTGCTCAGGGGCCAGGGGTCTGG - Intergenic
956265731 3:67393731-67393753 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
956322053 3:68008017-68008039 CCGCCCCGGGAGAAGGGGTGGGG + Intronic
956461829 3:69480641-69480663 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
956527340 3:70179456-70179478 CAGCTGAGGGAGCAGGGCGCTGG - Intergenic
957316568 3:78582969-78582991 CAGCTCATTGAGAACGGGCCAGG - Intergenic
957350645 3:79018984-79019006 CAGCTCCGGAGGAAGGGCTCGGG + Intronic
957488792 3:80896953-80896975 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
957806370 3:85153774-85153796 CAGCTCGGGGGTCAGGGGTCAGG - Intronic
957815346 3:85290624-85290646 CAGCTCAGGGGTCAAGGGTCAGG - Intronic
957893269 3:86387164-86387186 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
958200822 3:90312382-90312404 CTGCTCGGGGATCAGGGGTCAGG + Intergenic
958210519 3:90468304-90468326 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
958467196 3:94472718-94472740 CAGCTGAGAGGGGAGGGGTCAGG + Intergenic
958726303 3:97910054-97910076 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
958808186 3:98836581-98836603 CAGCTCATTGAGAACGGGCCAGG - Intronic
959042932 3:101440078-101440100 CAGCTCATTGAGAACGGGCCAGG + Intronic
959076333 3:101753328-101753350 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
959353458 3:105296918-105296940 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
959419001 3:106111020-106111042 CAGCTCATTGAGAACGGGCCAGG - Intergenic
959522336 3:107334445-107334467 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
959683959 3:109124636-109124658 CAGCTCATTGAGAACGGGCCGGG + Intergenic
959744412 3:109759977-109759999 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
960339343 3:116455895-116455917 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
960693963 3:120377922-120377944 CTGCTCAGGGATCAGGGGTCAGG + Intergenic
960698056 3:120414497-120414519 CAGCTCATTGAGAACGGGCCAGG + Intronic
960705220 3:120475085-120475107 AACCTCAGTGAGATGGGGTCAGG + Intergenic
960839045 3:121938071-121938093 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
960862380 3:122165410-122165432 CAGCTCATTGAGAACGGGCCAGG + Intergenic
961120073 3:124366692-124366714 CAGCTCATTGAGAACGGGCCAGG - Intronic
961303472 3:125937336-125937358 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
961657580 3:128451933-128451955 CAGTGCAGGGAGCAGGTGTCTGG - Intergenic
961712866 3:128840616-128840638 CAGCCCAGGGAGAAGGGGAGAGG + Intergenic
961729756 3:128955681-128955703 CAGCTCATTGAGAACGGGCCAGG + Intronic
962063345 3:131952748-131952770 CAGCTCATTGAGAACGGGCCAGG + Intronic
962112656 3:132470474-132470496 CAGCTCATTGAGAACGGGCCAGG - Intronic
962161439 3:133004940-133004962 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
962213614 3:133501080-133501102 GAGCTCTGGGATAAGGGGCCAGG + Intergenic
962245315 3:133785719-133785741 CAGCTCATTGAGAACGGGCCAGG + Intronic
962660347 3:137595925-137595947 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
962828273 3:139118687-139118709 CAACTCACGGAGAAAGGGTATGG + Intronic
963234627 3:142945019-142945041 CAGCTCCTGGAGAAGGGGAAGGG + Intergenic
963684802 3:148419973-148419995 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
963770403 3:149380906-149380928 CAGCTCATTGAGAACGGGCCAGG + Intergenic
964126683 3:153241067-153241089 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
964318581 3:155469761-155469783 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
964399471 3:156284273-156284295 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
964552219 3:157897511-157897533 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
964688488 3:159423767-159423789 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
964984121 3:162718136-162718158 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
965228859 3:166026407-166026429 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
965382868 3:168011729-168011751 CTGCTCAGGGGTAAGGGGTCAGG - Intronic
965717772 3:171625560-171625582 CTTCTCAGGGATCAGGGGTCAGG - Intronic
965974565 3:174605877-174605899 CTGCTCGGGGATCAGGGGTCAGG - Intronic
966015007 3:175131630-175131652 CAGCTCATTGAGAACGGGCCAGG - Intronic
966335256 3:178860647-178860669 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
966360266 3:179121587-179121609 CAGCTCATTGAGAACGGGCCAGG + Intergenic
966361251 3:179132144-179132166 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
966375312 3:179290785-179290807 CAGCTCATTGAGAAAGGGCCAGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967044124 3:185720783-185720805 CAGCTCAAGGAGAACAGCTCTGG - Intronic
967495912 3:190144886-190144908 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
968201722 3:196761644-196761666 CAGCTCATTGAGAACGGGCCAGG - Intronic
968644165 4:1730648-1730670 CAGCTCTGGGAGAAGCAGGCTGG - Intronic
968666931 4:1827776-1827798 CAGCTCATTGAGAACGGGCCAGG - Intronic
968864490 4:3199108-3199130 CAGCTCCTGGAGAAGGAGTCAGG - Intronic
968930152 4:3574642-3574664 AAGCTCAGGGAGACAGGGCCTGG + Intergenic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
968993074 4:3927732-3927754 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
969003332 4:4000192-4000214 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
969127141 4:4959193-4959215 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
969654203 4:8486900-8486922 CAGCCCAGGGAGGAGGGGAGAGG + Intronic
969810600 4:9644632-9644654 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
970087264 4:12364145-12364167 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
970206891 4:13664536-13664558 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
970358242 4:15279353-15279375 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
970489513 4:16557774-16557796 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
970546656 4:17137172-17137194 AATCTCAGGTAGAACGGGTCTGG + Intergenic
970853525 4:20629870-20629892 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
972001999 4:34049386-34049408 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
972136446 4:35900391-35900413 CAAGTCAGCAAGAAGGGGTCAGG + Intergenic
972854810 4:43093568-43093590 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
973281173 4:48363249-48363271 CAGCTCATTGAGAACGGGCCAGG - Intronic
973541483 4:51940390-51940412 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
973569461 4:52223657-52223679 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
973579240 4:52325094-52325116 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
973593924 4:52466093-52466115 CAGCTCATTGAGAACGGGCCAGG + Intergenic
973672646 4:53237327-53237349 CAGCTCATTGAGAACGGGCCAGG - Intronic
973776238 4:54244275-54244297 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
973784878 4:54325281-54325303 CAGCTCATTGAGAACGGGCCAGG - Intergenic
974097877 4:57384524-57384546 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
974143534 4:57918951-57918973 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
974542060 4:63250285-63250307 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
974588808 4:63918433-63918455 CAGCTCACTGAGAACGGGCCAGG - Intergenic
974591474 4:63953507-63953529 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
974661841 4:64900328-64900350 CAGCTCATTGAGAACGGGCCGGG + Intergenic
974673123 4:65057481-65057503 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
974690629 4:65293544-65293566 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
974849067 4:67384095-67384117 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
974956310 4:68645664-68645686 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
975187313 4:71419126-71419148 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
975283853 4:72594412-72594434 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
975368045 4:73551330-73551352 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
975505024 4:75127505-75127527 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
975750604 4:77519226-77519248 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
976039081 4:80860842-80860864 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
976087494 4:81421122-81421144 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
976265320 4:83182867-83182889 CAGCTCATTGAGAACGGGCCGGG + Intergenic
976271579 4:83235713-83235735 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
976382866 4:84420184-84420206 GACCTCAGTGAGAAGGGGTGAGG - Intergenic
976996305 4:91438190-91438212 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
977041674 4:92026117-92026139 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
977205219 4:94158353-94158375 CAGCTCATTGAGAACGGGCCAGG + Intergenic
978518800 4:109597220-109597242 CAGCTCATTGAGAACGGGCCAGG - Intronic
978663139 4:111152483-111152505 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
978893095 4:113852842-113852864 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
979248353 4:118535458-118535480 CAGCTCATTGAGAACGGGCCAGG + Intergenic
980056304 4:128083304-128083326 CAGCTCATTGAGAACGGGCCAGG - Intronic
980149109 4:129024256-129024278 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
980426791 4:132636583-132636605 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
980593130 4:134917333-134917355 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
980612986 4:135183032-135183054 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
980781471 4:137496965-137496987 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
980829521 4:138113026-138113048 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
980895367 4:138854772-138854794 CAGCTCATTGAGAACGGGCCAGG + Intergenic
980904409 4:138933420-138933442 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
981005580 4:139871673-139871695 CAGCTCAGGGAGGAGGACCCAGG - Intronic
981523919 4:145693520-145693542 CAGCTCATTGAGAACGGGCCAGG - Intronic
981607755 4:146558355-146558377 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
981618179 4:146664310-146664332 CTGCTCAGGGCTCAGGGGTCAGG - Intergenic
981684174 4:147434720-147434742 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
981970873 4:150660575-150660597 CAGCTCATTGAGAACGGGCCAGG + Intronic
982025998 4:151254809-151254831 CAGCTCATTGAGAACGGGCCAGG - Intronic
982318532 4:154056830-154056852 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
982397044 4:154924254-154924276 CAGCGTAGGGAGATGGGGTGGGG + Intergenic
982497458 4:156108996-156109018 CAGCGAAGGGAGATGGGGTTGGG + Intergenic
982615570 4:157636312-157636334 CAGCTCATTGAGAACGGGCCAGG - Intergenic
982651172 4:158089550-158089572 CTGCTCGGGGATCAGGGGTCAGG + Intergenic
983101646 4:163632932-163632954 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
983190250 4:164747238-164747260 CAGCTCATTGAGAACGGGCCAGG - Intergenic
983341298 4:166464014-166464036 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
983346071 4:166526307-166526329 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
983799044 4:171903829-171903851 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
984322731 4:178213219-178213241 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
984386890 4:179072269-179072291 CGGCTCAGGCAGATTGGGTCTGG + Intergenic
984430031 4:179637223-179637245 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
984533716 4:180945443-180945465 CAGCTCATTGAGAACGGGCCAGG + Intergenic
984597861 4:181691846-181691868 CTGCTCTGGGAGATGGGGTGGGG - Intergenic
984696375 4:182784360-182784382 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
985255719 4:188068230-188068252 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1202759401 4_GL000008v2_random:96706-96728 CTGCTCAGGGGTCAGGGGTCTGG + Intergenic
985727358 5:1523396-1523418 CGGTTCAGGGTGCAGGGGTCTGG + Intronic
986665750 5:10102532-10102554 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
986906123 5:12494393-12494415 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
987072850 5:14354142-14354164 CTGCTCAGACAGTAGGGGTCAGG - Intronic
987267834 5:16276666-16276688 CAGCTCATTGAGAACGGGCCAGG - Intergenic
987443636 5:17988136-17988158 CAGCTAATGGAGAAGGGACCAGG + Intergenic
988003899 5:25383838-25383860 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
988210778 5:28200503-28200525 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
988239950 5:28596726-28596748 CAGCTCATTGAGAACGGGCCGGG - Intergenic
988405911 5:30823280-30823302 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
988547765 5:32174192-32174214 CAGGTCAGGGCGAAGCGGGCTGG + Exonic
988690731 5:33569304-33569326 CTGCTCAGGGAACAGGGGTCAGG - Intronic
988760077 5:34305502-34305524 CAGCTCATTGAGAACGGGCCAGG - Intergenic
988871632 5:35396786-35396808 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
988887419 5:35573528-35573550 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
989129533 5:38092993-38093015 CAGCTCATGGAAGATGGGTCAGG - Intergenic
989138015 5:38174808-38174830 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
989226502 5:39035029-39035051 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
989442880 5:41493365-41493387 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
989467882 5:41778432-41778454 CAGTTTAGAGAGAAGAGGTCTGG + Intronic
989544801 5:42660318-42660340 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
989615407 5:43333093-43333115 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
989965107 5:50458295-50458317 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
989968149 5:50489417-50489439 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
990426583 5:55695755-55695777 CAGCTCATTGAGAACGGGCCAGG - Intronic
990458784 5:56014408-56014430 CAGCTCATTGAGAACGGGCCGGG - Intergenic
990600784 5:57356806-57356828 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
990708530 5:58557572-58557594 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
990825601 5:59894051-59894073 CAGCTCCGGGATCAGGGTTCCGG - Intronic
990838558 5:60049672-60049694 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
991167642 5:63582492-63582514 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
991542180 5:67742211-67742233 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
991545848 5:67780721-67780743 CTGCTCAGGGTTCAGGGGTCAGG - Intergenic
992034928 5:72763668-72763690 CATCCCAGGAAGAAGGGGACAGG - Intergenic
992348111 5:75901519-75901541 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
992374262 5:76172553-76172575 CAGCTCATTGAGAACGGGCCAGG + Intronic
992469459 5:77042298-77042320 CAGCTCATTGAGAACGGGCCAGG - Intronic
992525845 5:77609364-77609386 CTGCTCAGGGGTCAGGGGTCGGG - Intronic
992544158 5:77794798-77794820 CAGCTCATCGAGAACGGGCCAGG - Intronic
992755661 5:79902995-79903017 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
992864514 5:80943823-80943845 CAGCTCATTGAGAACGGGACGGG - Intergenic
992978479 5:82140730-82140752 CAGCTCATTGAGAACGGGCCAGG + Intronic
993094151 5:83463103-83463125 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
993449183 5:88053029-88053051 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
993624586 5:90209033-90209055 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
993657450 5:90594972-90594994 CAGCTCATTGAGAACGGGCCAGG - Intronic
994120570 5:96108530-96108552 CTGCTCGGGGATCAGGGGTCAGG + Intergenic
994270589 5:97771908-97771930 CTGCTCAGGCATCAGGGGTCAGG + Intergenic
994324561 5:98434829-98434851 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
994623472 5:102190180-102190202 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
994662659 5:102671922-102671944 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
994693599 5:103047438-103047460 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
994776147 5:104037190-104037212 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
995193994 5:109343013-109343035 CAGCTCATTGAGAACGGGCCAGG + Intronic
995247214 5:109948016-109948038 AAGCTCCTGGAGAAGGGGTAAGG - Intergenic
995343885 5:111090189-111090211 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
995414070 5:111889791-111889813 CAGCAAAGGGAGATGGGGTGGGG + Intronic
995423298 5:111991394-111991416 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
995471100 5:112503083-112503105 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
995516090 5:112955299-112955321 CAGCTCATTGAGAACGGGCCAGG + Intergenic
995676813 5:114671570-114671592 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
995898892 5:117046518-117046540 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
995923677 5:117343563-117343585 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
996069758 5:119121769-119121791 CAGCTCATTGAGAACGGGCCAGG - Intronic
996212770 5:120832125-120832147 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
996231112 5:121064937-121064959 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
996419045 5:123241915-123241937 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
997293842 5:132757364-132757386 CTGCTCAGGGAGAAGTGGAGGGG - Intronic
997336061 5:133109281-133109303 CAGCTCATTGAGAACGGGCCAGG + Intergenic
997497848 5:134345565-134345587 CAGCAAAGGGAGATGGGGTGGGG + Intronic
997590101 5:135067128-135067150 CATGCCAGGGAGGAGGGGTCGGG - Intronic
997793838 5:136788109-136788131 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
998067655 5:139171207-139171229 CAGCTCATTGAGAACGGGCCGGG + Intronic
998431569 5:142075137-142075159 CAGCTCATTGAGAACGGGCCAGG - Intergenic
998633273 5:143925061-143925083 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
999189966 5:149739881-149739903 GAGCTCAGAGAGGAGGGGCCTGG + Intronic
999275246 5:150325681-150325703 CAGCTCAGAGGGAAAGGATCTGG - Intronic
999580886 5:153036790-153036812 CAGCTCATTGAGAACGGGCCAGG + Intergenic
999663698 5:153891535-153891557 CAGCTCAGGGAGTCAGGGACAGG + Intergenic
1000404635 5:160874220-160874242 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1000468658 5:161611363-161611385 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1000607537 5:163340471-163340493 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1000731511 5:164839733-164839755 CAGCCCAGGAAGAAGTGGTCAGG - Intergenic
1000884953 5:166740154-166740176 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1000985905 5:167860549-167860571 CAGCTCATTGAGAACGGGCCAGG + Intronic
1001077701 5:168643142-168643164 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1001393893 5:171403494-171403516 CAGCTCATTGAGAACGGGCCAGG - Intronic
1001922041 5:175608506-175608528 CAGCTCTGGGAGAGGGGGCCTGG - Intergenic
1002011055 5:176281862-176281884 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1002014240 5:176306419-176306441 CAGCTCATTGAGAACGGGCCAGG + Intronic
1002104893 5:176875160-176875182 CCGCTCGGGGAGAAGGGCACTGG - Intronic
1002116280 5:176962654-176962676 CAGCTCATTGAGAACGGGCCAGG + Intronic
1002205423 5:177559954-177559976 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1002334483 5:178468543-178468565 CAGCTCAGAGGGACGGGGCCGGG - Intronic
1002341295 5:178518384-178518406 CAGCTCATTGAGAACGGGCCAGG - Intronic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1002838442 6:885206-885228 GAGCTCAGTGAGAAGGGTGCTGG - Intergenic
1002843028 6:922358-922380 CAGCTCAGGGATAAAGGATGGGG + Intergenic
1002974918 6:2065108-2065130 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1003044749 6:2723671-2723693 GAGCTCAGGTAGAAGTGGTCGGG + Intronic
1003296611 6:4835505-4835527 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1003429693 6:6027907-6027929 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1003892495 6:10575931-10575953 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1004040743 6:11972710-11972732 CCGCTGAGGGAGAAGTTGTCGGG - Intergenic
1004388560 6:15190077-15190099 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1004402750 6:15304168-15304190 CAGCTGAGGGCGCAGGGCTCAGG + Intronic
1004448636 6:15726045-15726067 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1005083585 6:21981319-21981341 CAGCTCAGGAAGGAGGAGGCAGG - Intergenic
1005263221 6:24083542-24083564 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1005284643 6:24312200-24312222 CAGCAAAGGGAGATGGGGTGAGG - Intronic
1005606597 6:27484589-27484611 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1005644280 6:27826665-27826687 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1005785853 6:29245578-29245600 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1005859492 6:29889580-29889602 CATCTCAGGGTGAGGGGCTCGGG - Intergenic
1005868751 6:29957689-29957711 CATCTCAGGGTGAGGGGCTCTGG - Intergenic
1005883408 6:30076274-30076296 CAGCTCTGGGGTAAGGGGTGGGG + Intergenic
1005905954 6:30261455-30261477 CATCTCAGGGTGAGGGGCTCTGG - Intergenic
1005929915 6:30475492-30475514 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1005932056 6:30491388-30491410 CATCTCAGGGTGACGGGCTCGGG - Exonic
1005958432 6:30680296-30680318 AAGCTCAGGGGGAAGGGGCAGGG + Intronic
1006040058 6:31244809-31244831 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1006064474 6:31454235-31454257 CAGCTCATTGAGAACGGGCCGGG - Intergenic
1006108294 6:31729555-31729577 CAGCTGAGGGTTAAGGGGGCGGG - Exonic
1006128192 6:31853771-31853793 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1006231805 6:32594670-32594692 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1006351738 6:33525655-33525677 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1006502356 6:34466735-34466757 CAGCTGTGGGGGAAGGGGTAGGG - Intronic
1006617674 6:35340822-35340844 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1006624105 6:35385142-35385164 CAGCTCATTGAGAACGGGCCAGG + Intronic
1007063346 6:38964184-38964206 CAGCTCATTGAGAACGGGCCAGG - Intronic
1007084858 6:39136175-39136197 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1007813302 6:44501928-44501950 AAGCTCAGGGAGAAAGGACCAGG - Intergenic
1008412194 6:51193096-51193118 CTGCTCAGGTATCAGGGGTCAGG + Intergenic
1009176007 6:60460653-60460675 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1010137351 6:72570836-72570858 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1010318960 6:74484705-74484727 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
1010498255 6:76562575-76562597 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1010695779 6:78972213-78972235 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1010983360 6:82394724-82394746 CTGCTCGGGGATCAGGGGTCAGG + Intergenic
1010998379 6:82559099-82559121 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
1011009515 6:82687903-82687925 CTGCGCAGGCAGAAGGGGTGAGG + Intergenic
1011107875 6:83803049-83803071 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1011179997 6:84609135-84609157 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1011244490 6:85307737-85307759 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1011379955 6:86732088-86732110 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
1011404954 6:87009549-87009571 CAGCTCATTGAGAACGGGCCAGG - Intronic
1011550361 6:88526629-88526651 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1011588526 6:88948618-88948640 CAGCTCATTGAGAACGGGCCAGG + Intronic
1012087754 6:94851830-94851852 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1012285384 6:97381985-97382007 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1012540411 6:100355401-100355423 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1012673698 6:102088893-102088915 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1012969797 6:105716823-105716845 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1013204886 6:107935297-107935319 CAGCTCACTGAGAACGGGCCGGG + Intronic
1013326288 6:109047601-109047623 CAGCTCATTGAGAACGGGCCAGG + Intronic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013679517 6:112508823-112508845 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1013690173 6:112632615-112632637 CTGCTCGGGGATCAGGGGTCAGG + Intergenic
1013898437 6:115121949-115121971 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1014025351 6:116639397-116639419 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1014076865 6:117245450-117245472 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1014145752 6:117996489-117996511 CTGCTCAGGGATCAGGGGTCAGG - Intronic
1014364530 6:120523033-120523055 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1014556614 6:122848274-122848296 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1014710919 6:124805199-124805221 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1014877060 6:126674252-126674274 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
1015077120 6:129172481-129172503 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1015164878 6:130192588-130192610 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1015357709 6:132298524-132298546 CAGATCAGCCAGCAGGGGTCAGG - Intronic
1015432445 6:133147379-133147401 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1015477035 6:133665690-133665712 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1015697765 6:136000907-136000929 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1015899643 6:138051591-138051613 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1016102603 6:140120730-140120752 CCTCTCAGGGAGTGGGGGTCTGG + Intergenic
1016973347 6:149785895-149785917 CAGCTCATTGAGAACGGGCCAGG - Intronic
1017028553 6:150201506-150201528 GAGCTCAGGGAGTTGGGGTGAGG + Intronic
1017157328 6:151333926-151333948 CAGCACAGGAAGAAGGGTCCTGG + Intronic
1017170550 6:151450708-151450730 CAGCTCATTGAGAACGGGACGGG + Intronic
1017420005 6:154263733-154263755 CAGCTCATTGAGAACGGGCCAGG - Intronic
1017624037 6:156330290-156330312 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1017830899 6:158127503-158127525 CAGCTCATTGAGAACGGGCCAGG + Intronic
1017843177 6:158238915-158238937 CAGCTCATTGAGAACGGGCCAGG - Intronic
1018029628 6:159831686-159831708 CAGCTCAGGGTGATAAGGTCTGG + Intergenic
1018126176 6:160685030-160685052 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1018354172 6:162995047-162995069 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1018495803 6:164344470-164344492 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1018586700 6:165368786-165368808 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1018623042 6:165750376-165750398 CAGCTCAGGGAGCAGGAGTCTGG + Intronic
1018778905 6:167044748-167044770 CAGCCCTGGGAGGAGGGGCCGGG + Exonic
1019181135 6:170187841-170187863 CAGCTCAGGGACAAGGGGCCCGG - Intergenic
1019267331 7:125209-125231 CAGCACAGGGTGGAGGGGCCAGG - Intergenic
1019402975 7:866782-866804 AGGCCCAGGGAGAAGGGGGCGGG - Intronic
1019439792 7:1039679-1039701 CAGCTCATTGAGAACGGGCCAGG + Intronic
1019669391 7:2269036-2269058 CAGCTCATTGAGAACGGGCCAGG + Intronic
1020350058 7:7209832-7209854 CAGCGAAGGGAGATGGGGTGGGG + Intronic
1020498920 7:8890792-8890814 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1020616190 7:10465211-10465233 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1020779335 7:12497919-12497941 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1021146345 7:17093805-17093827 CAGCTTGGGGAGAAGGGGTAGGG - Intergenic
1021319634 7:19194355-19194377 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1022005585 7:26262526-26262548 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1022393194 7:29961557-29961579 CAGCTCACTGAGAACGGGCCAGG - Intronic
1022514748 7:30968519-30968541 CAGCTCAGGAAGCAGAGGTTAGG - Intronic
1022514906 7:30969316-30969338 CAGCTCAGGAAGCAGAGATCAGG - Intronic
1022572282 7:31466961-31466983 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1022586745 7:31620317-31620339 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1022630812 7:32082560-32082582 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1022708787 7:32832894-32832916 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1022709577 7:32838150-32838172 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1023056722 7:36296500-36296522 CAGCACAGGGAAAGGTGGTCAGG - Intronic
1023147705 7:37168771-37168793 CTGCTCAGGGTTCAGGGGTCAGG + Intronic
1023322422 7:39012831-39012853 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1023494408 7:40779031-40779053 CAGATCAGGCAGAATGGCTCAGG + Intronic
1023870023 7:44258163-44258185 TAGCTCAGTGAGAAGGTGTCTGG - Intronic
1024123792 7:46271155-46271177 GAGCCCAGGGAGATGGGGCCAGG + Intergenic
1024205172 7:47152717-47152739 CAGCTCAGAGATAAGAGGCCTGG + Intergenic
1024303802 7:47909278-47909300 CAGCTGAGAGGGAAGGGCTCAGG - Intronic
1024988859 7:55219564-55219586 CAGCTCATTGAGAACGGGCCAGG - Intronic
1025184098 7:56843811-56843833 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1025687830 7:63733157-63733179 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1025795771 7:64738276-64738298 CAGCTCACTGAGAACGGGCCGGG - Intergenic
1025803413 7:64809072-64809094 CAGCTCATTGAGAACGGGCCAGG - Intronic
1026783136 7:73283776-73283798 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1027087576 7:75275235-75275257 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1027354942 7:77345758-77345780 CAGCGAAGGGAGATGGGGTGGGG - Intronic
1027371441 7:77510085-77510107 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1027892484 7:83994622-83994644 CTGCTCCGGGATCAGGGGTCAGG + Intronic
1027896748 7:84055010-84055032 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1027903645 7:84150925-84150947 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1027989169 7:85335028-85335050 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1028355560 7:89902196-89902218 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1028441986 7:90874120-90874142 CAGCTCAGGGAAGAGGGGAAGGG - Intronic
1028468039 7:91174142-91174164 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1028489424 7:91394787-91394809 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1028537768 7:91908989-91909011 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1028589309 7:92479298-92479320 CAGCTAAGGGAGATGGGGTGGGG + Intergenic
1028946393 7:96585275-96585297 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1029468419 7:100740788-100740810 CAGCTCATTGAGAACGGGCCAGG - Intronic
1029568898 7:101358485-101358507 CAGCTCATTGAGAACGGGCCGGG - Intergenic
1029916042 7:104210429-104210451 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1030418170 7:109271700-109271722 CAGCTGAGGGAGAATGGAGCTGG + Intergenic
1030603006 7:111610661-111610683 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1030652267 7:112128424-112128446 CAGCTCATTGAGAACGGGCCAGG + Intronic
1030751834 7:113238941-113238963 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1031266393 7:119587405-119587427 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1031422774 7:121569369-121569391 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1031617184 7:123895197-123895219 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1031635752 7:124099490-124099512 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1031776995 7:125917844-125917866 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1032369099 7:131328195-131328217 GAGCCCAGGGAGAAGGGGCGAGG + Intronic
1032429534 7:131849572-131849594 CAGCTCAGGGACAAGGGGAAAGG + Intergenic
1032429555 7:131849686-131849708 CAGCTCTGGGACAAGTGTTCAGG + Intergenic
1032944302 7:136831887-136831909 CTGCTCAGGGGTTAGGGGTCAGG - Intergenic
1032972584 7:137182308-137182330 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1032993993 7:137425106-137425128 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1033114322 7:138611902-138611924 CAGCTCATTGAGAACGGGCCAGG + Intronic
1033424096 7:141227677-141227699 CTGCTCTGAGAGAATGGGTCTGG + Intronic
1033460315 7:141541608-141541630 GAGCCCAGGGAGAAGGAGGCAGG - Intergenic
1033464443 7:141578178-141578200 CAGCGAAGGGAGATGGGGTGGGG + Intronic
1034017352 7:147601300-147601322 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1034084249 7:148309517-148309539 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1034200290 7:149279956-149279978 CAGCTCATTGAGAACGGGCCGGG - Intronic
1034234411 7:149555352-149555374 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1034322700 7:150199112-150199134 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1035310865 7:157967827-157967849 GAATCCAGGGAGAAGGGGTCTGG + Intronic
1035461592 7:159042449-159042471 CAGCTGAGGGAGAAGGGCGTGGG + Intronic
1035507657 8:149334-149356 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1035586406 8:778647-778669 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1035792761 8:2323016-2323038 CAGCTCGGGGGTCAGGGGTCAGG + Intergenic
1035800043 8:2398689-2398711 CAGCTCGGGGGTCAGGGGTCAGG - Intergenic
1036482907 8:9153892-9153914 CAGCTCATTGAGAACGGGCCAGG - Intronic
1036506872 8:9364862-9364884 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1036536454 8:9657108-9657130 CAGCTCATTGAGAACGGGCCAGG - Intronic
1036810720 8:11866528-11866550 CAGCTCCTGGAGAAAGGGGCTGG - Intronic
1037214982 8:16438377-16438399 AATCTCAGGAAGAAGTGGTCAGG + Intronic
1037620154 8:20556339-20556361 CAACCCATGGAGAAGAGGTCAGG - Intergenic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1037774809 8:21826415-21826437 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1037928462 8:22863609-22863631 CAGAGCAGTGAGAAGGGGTGGGG - Intronic
1037992597 8:23331322-23331344 CAGAGGAGGGAGAAGGGCTCTGG - Intronic
1038107626 8:24454084-24454106 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1039669460 8:39580326-39580348 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1039881071 8:41626198-41626220 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1040099761 8:43488556-43488578 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1040373311 8:46798026-46798048 CTGCTCAGGGGTTAGGGGTCAGG - Intergenic
1040405724 8:47100260-47100282 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1040676587 8:49757665-49757687 CAGCCCAGGGAGAGGGACTCTGG - Intergenic
1040989894 8:53338354-53338376 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1041071011 8:54125947-54125969 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1041260956 8:56020143-56020165 AAGCACAGGGAGAAGGCCTCGGG - Intergenic
1041301479 8:56415921-56415943 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1041439086 8:57874586-57874608 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1041482006 8:58332181-58332203 CTGCCCAGTGAGAAGGGATCTGG - Intergenic
1041613140 8:59875107-59875129 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1041736882 8:61120679-61120701 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1041796268 8:61752360-61752382 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1041806028 8:61850434-61850456 CTGCTCAGGGGTGAGGGGTCAGG + Intergenic
1041976238 8:63802719-63802741 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1042049348 8:64686635-64686657 CAGCTCATTGAGAACGGGCCAGG + Intronic
1042303893 8:67311744-67311766 CAGCTCATTGAGAACGGGCCAGG + Intronic
1042319638 8:67461549-67461571 CAGCTCATTGAGAACGGGCCGGG - Intronic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042410525 8:68460500-68460522 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1042475908 8:69246367-69246389 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1042970381 8:74401985-74402007 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1043037537 8:75217175-75217197 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1043042410 8:75279066-75279088 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1043119833 8:76308802-76308824 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1043272416 8:78351201-78351223 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1043596910 8:81898119-81898141 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1043717377 8:83504804-83504826 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1043718234 8:83510623-83510645 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1044661075 8:94591862-94591884 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1044882993 8:96743782-96743804 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1045044482 8:98260964-98260986 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1045265692 8:100617031-100617053 CAGCAGATGGAAAAGGGGTCTGG + Intronic
1045698159 8:104834761-104834783 CAGATCGGGGATAAGGGGTTGGG - Intronic
1045718270 8:105074454-105074476 CAGGCCAGAGTGAAGGGGTCAGG + Intronic
1045775197 8:105794512-105794534 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1046122088 8:109859331-109859353 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1046422642 8:114005598-114005620 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1046550544 8:115710248-115710270 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1047267129 8:123316090-123316112 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1047328713 8:123865287-123865309 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1047434773 8:124827157-124827179 CAGCTCAGGGAAAACGGCACTGG - Intergenic
1047520334 8:125591109-125591131 CAGCTCAGGGAAAAGAGGCTGGG - Intergenic
1047587127 8:126284534-126284556 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1047687676 8:127317387-127317409 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1047847634 8:128825469-128825491 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1048006365 8:130422449-130422471 CAGCCCAGGGAGCAGGAGCCAGG - Intronic
1048425521 8:134319663-134319685 CAGCCCAGGGAGAGGGTGTGAGG + Intergenic
1048585780 8:135772683-135772705 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1048668113 8:136687200-136687222 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1048728708 8:137413585-137413607 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1048792552 8:138116862-138116884 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1049243510 8:141550367-141550389 CAGCAGAGGGAGCAGGGGCCAGG + Intergenic
1049277862 8:141728910-141728932 CACGTCAGGGAGAATTGGTCAGG + Intergenic
1049362835 8:142220413-142220435 GAGCTCAGGGAGGCTGGGTCTGG + Intronic
1049542260 8:143213968-143213990 CAGATCAGGCAGCAGGGCTCTGG - Intergenic
1049642364 8:143721450-143721472 CAGCACAGGCAGAAGGGGCCCGG - Intronic
1050310672 9:4350095-4350117 CAGCATAGTGAGAAGGGATCAGG + Intergenic
1050486183 9:6136543-6136565 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1050558382 9:6808200-6808222 CAGCTCATTGAGAACGGGCCAGG + Intronic
1051277110 9:15407235-15407257 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1051299076 9:15628738-15628760 CTGCTCAGGGTTCAGGGGTCAGG - Intronic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1051661749 9:19433642-19433664 CAGCTCATTGAGAACGGGCCAGG - Intronic
1051778044 9:20658084-20658106 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1052395736 9:27935779-27935801 AAGGTCAGGGAGAAAGGGTTAGG - Intergenic
1052478351 9:28990564-28990586 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1052513489 9:29451091-29451113 CCGCTCAGGGGTCAGGGGTCAGG - Intergenic
1052726140 9:32230338-32230360 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1053057804 9:35004427-35004449 GGGCTCAGAGATAAGGGGTCAGG - Intergenic
1053255654 9:36614925-36614947 CAGCTCATTGAGAACGGGCCAGG - Intronic
1053457649 9:38243096-38243118 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1053468288 9:38325473-38325495 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1053634544 9:39983375-39983397 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1054209343 9:62267322-62267344 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1055133760 9:72806032-72806054 CAGCTCATTGAGAATGGGCCCGG - Intronic
1055136904 9:72840079-72840101 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1055414029 9:76063817-76063839 CAGCTCATTGAGAACGGGCCAGG - Intronic
1055574001 9:77644852-77644874 CAGCATAGGGAGAAAGTGTCAGG - Intronic
1055776522 9:79771921-79771943 GAGCTCAGAGTGAAGGGGTGAGG + Intergenic
1055827594 9:80345574-80345596 CTGCTCGGGGATTAGGGGTCAGG - Intergenic
1055834176 9:80419396-80419418 CACCTCATGGAAAAGTGGTCAGG - Intergenic
1055948748 9:81711416-81711438 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1056096479 9:83259773-83259795 CACCTCAGGAGGAATGGGTCTGG - Intronic
1056152899 9:83804975-83804997 CAGCTCATTGAGAACGGGCCGGG + Intronic
1056363174 9:85879331-85879353 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1056393278 9:86157786-86157808 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1056484019 9:87035994-87036016 CAGTTCAGGGTGAATGTGTCGGG - Intergenic
1056670973 9:88626533-88626555 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1057069796 9:92087677-92087699 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1057525501 9:95796050-95796072 CAGGTCAGGGGGAACTGGTCAGG - Intergenic
1057629298 9:96707325-96707347 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1057813242 9:98273922-98273944 CAGTGCAGGGAGATGGGGTGGGG + Intergenic
1058215101 9:102223213-102223235 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1058659447 9:107256542-107256564 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1058723220 9:107777785-107777807 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1059211502 9:112515391-112515413 CAGCTCATTGAGAACGGGCCAGG + Intronic
1059738958 9:117130875-117130897 GTGCTCAGGGAGAAGGGGAAGGG - Intronic
1059906486 9:118992173-118992195 AAGCTCAGGGAGCAGGGATGGGG + Intergenic
1059922027 9:119169816-119169838 CTGCTCAGGGGTCAGGGGTCAGG - Intronic
1060065492 9:120496917-120496939 CAGCTCATTGAGAACGGGCCAGG + Intronic
1060249247 9:121971576-121971598 CAGCTCATTGAGAACGGGCCAGG + Intronic
1060651173 9:125328688-125328710 CAGCTCATTGAGAACGGGCCAGG - Intronic
1060703452 9:125779747-125779769 CAGCTCATTGAGAACGGGCCGGG - Intronic
1060919937 9:127413539-127413561 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1061277730 9:129579075-129579097 CTCCACAGGGAAAAGGGGTCTGG + Intergenic
1061306622 9:129736251-129736273 AAGCTCAAGGTGGAGGGGTCTGG + Intergenic
1061920823 9:133781466-133781488 CAGCTCAGTGGGCAGGGGTCAGG + Intronic
1061982567 9:134115270-134115292 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1062121723 9:134837406-134837428 CAGATTAGGGAGCAGGGGTCTGG - Intronic
1062253354 9:135609133-135609155 AAGCCCAGGGGGAAGGGGTTGGG - Intergenic
1062309153 9:135926653-135926675 CAGCTGAAGGAGAGAGGGTCCGG - Intergenic
1062353698 9:136152068-136152090 CAGCTTTGGGCGAGGGGGTCTGG + Intergenic
1062569692 9:137179381-137179403 CAGCTCGGGGAGGAAGGGTTAGG - Intronic
1062593904 9:137288654-137288676 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1062655775 9:137604218-137604240 CAGGTCAGGGAGGAGGAGTCTGG - Intergenic
1062722289 9:138050744-138050766 CAGCTGAGGGAAGAGGGGACAGG - Intronic
1203380144 Un_KI270435v1:28930-28952 CTGCTCAGGGTTCAGGGGTCAGG - Intergenic
1203397896 Un_KI270519v1:44565-44587 CTGCTCAGGGTTCAGGGGTCAGG - Intergenic
1203540177 Un_KI270743v1:81601-81623 CTGCTCAGGGGTCAGGGGTCTGG + Intergenic
1185960207 X:4540577-4540599 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1186176814 X:6933193-6933215 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1186243279 X:7593027-7593049 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1186314642 X:8356167-8356189 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1186476097 X:9858820-9858842 AAGCTGAGTGAGAAGGGGTGAGG + Intronic
1186730633 X:12405806-12405828 CAACTCAGGGACAATGGGGCAGG + Intronic
1186787114 X:12963926-12963948 CAGCTCATTGAGAACGGGCCGGG + Intergenic
1186905767 X:14109255-14109277 CTGCTCAGGGATCAGGGGTCAGG + Intergenic
1187477476 X:19625037-19625059 CAGTTCAGAGAGAAAGGGTCAGG + Intronic
1187976277 X:24708873-24708895 CAGCTCATTGAGAACGGGCCAGG - Intronic
1188420614 X:29987164-29987186 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1188477553 X:30603387-30603409 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1189562668 X:42207463-42207485 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1189583249 X:42430165-42430187 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1189956065 X:46276149-46276171 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1190213913 X:48467826-48467848 GGGCTCAGGGATCAGGGGTCAGG - Intronic
1190519491 X:51262699-51262721 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1190521263 X:51280476-51280498 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1190536398 X:51432878-51432900 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1190615184 X:52222792-52222814 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1190713884 X:53088243-53088265 CAGCACAGGGAGAGGGGCTGGGG - Exonic
1190891414 X:54572493-54572515 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1191064187 X:56330426-56330448 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1191187639 X:57630088-57630110 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1191273509 X:58511062-58511084 CAGCTCAGGGGCCAGGGCTCGGG - Intergenic
1191617868 X:63189099-63189121 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1191649371 X:63519820-63519842 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1191709752 X:64137189-64137211 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1191723720 X:64257655-64257677 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1191747195 X:64502516-64502538 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1191855219 X:65620014-65620036 CTGCTCGGGGATCAGGGGTCAGG + Intronic
1192029014 X:67489034-67489056 TTGCTCAGGGATCAGGGGTCAGG - Intergenic
1192041946 X:67631945-67631967 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1192154865 X:68736943-68736965 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1192280709 X:69682127-69682149 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1192290385 X:69788598-69788620 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1192293992 X:69828006-69828028 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1192412099 X:70943392-70943414 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1192621684 X:72682431-72682453 CAGCTCATTGAGAACGGGCCAGG + Intronic
1192706041 X:73529285-73529307 CAGCTTAGGGAGGAGGGGAGAGG - Intergenic
1192843123 X:74878295-74878317 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1192944292 X:75949271-75949293 GGGCTCAGGGAGATAGGGTCTGG - Intergenic
1192969573 X:76217641-76217663 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1193132160 X:77931501-77931523 CAGCTCATTGAGAACGGGCCGGG - Intronic
1193399656 X:81027536-81027558 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
1193655087 X:84188343-84188365 CAGCTTGGGGTGAAGGGGGCGGG + Intergenic
1193718361 X:84958417-84958439 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1193785645 X:85757146-85757168 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1193817193 X:86118627-86118649 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1193831526 X:86294727-86294749 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1193886393 X:86987364-86987386 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1193896164 X:87117006-87117028 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1193906629 X:87253047-87253069 CAGATCAGGATGAAGAGGTCAGG - Intergenic
1194200979 X:90952516-90952538 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1194660359 X:96624310-96624332 CAGCAGAGGGAGATGGGGTGGGG - Intergenic
1195035926 X:100972217-100972239 CAGCTCATTGAGAACGGGCCAGG - Intronic
1195099542 X:101541034-101541056 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1195517865 X:105797606-105797628 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1195639393 X:107156465-107156487 CTGCTCGGGGATCAGGGGTCAGG - Intronic
1196183357 X:112719308-112719330 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1196350696 X:114725821-114725843 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1196404160 X:115346986-115347008 CAGCTCATTGAGAACGGGCCAGG - Intergenic
1196481942 X:116159897-116159919 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1196626146 X:117879307-117879329 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1196778153 X:119359921-119359943 TAGCTCAGGGAGATGTGGCCAGG - Intergenic
1197077924 X:122375368-122375390 CAGCTGAGGCAGAAGGGGAGAGG + Intergenic
1197089905 X:122523831-122523853 CAGCCCTGGGAGAAGTGGTCAGG - Intergenic
1197410450 X:126109429-126109451 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1197492194 X:127131006-127131028 CATTTCTGGGAGAATGGGTCTGG - Intergenic
1197649057 X:129044917-129044939 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1197824320 X:130572977-130572999 CTGCTCAGGGATCAGGGGTCAGG + Intergenic
1197917656 X:131553386-131553408 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1198598934 X:138264459-138264481 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1198599723 X:138269734-138269756 CAGCGAAGGGAGATGGGGTGGGG + Intergenic
1198994975 X:142564009-142564031 CAGCGAAGGGAGATGGGGTGGGG - Intergenic
1199452523 X:147992146-147992168 CAGCTCATTGAGAACGGGACGGG - Intronic
1199523883 X:148769763-148769785 CAAGTTAAGGAGAAGGGGTCTGG - Intronic
1199586584 X:149421276-149421298 CAGCTCATTGAGAACGGGCCAGG + Intergenic
1199906830 X:152241304-152241326 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1200280527 X:154773789-154773811 CAGCTCATTGAGAACGGGCCAGG - Intronic
1200812712 Y:7502010-7502032 CAGCCCAGGGACAAGGGGAGAGG - Intergenic
1201362191 Y:13164595-13164617 CAGCAAAGGGAGATGGGGTAGGG + Intergenic
1201393647 Y:13524714-13524736 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1201413306 Y:13722646-13722668 CTGCTCAGGGATCAGGGGTCAGG - Intergenic
1201431782 Y:13909962-13909984 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1201435351 Y:13952520-13952542 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1201441498 Y:14013226-14013248 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1201443072 Y:14029481-14029503 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1201450151 Y:14102835-14102857 CTGCTCGGGGATCAGGGGTCAGG - Intergenic
1201635639 Y:16120012-16120034 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic
1201703754 Y:16912888-16912910 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1201886869 Y:18894597-18894619 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1202200729 Y:22344924-22344946 CTGCTCAGGGGTCAGGGGTCAGG + Intronic
1202249552 Y:22855640-22855662 CTGCTCAGGGGTCAGGGGTCAGG - Intergenic
1202468241 Y:25180695-25180717 CTGCTCAGGGGTCAGGGGTCAGG + Intergenic