ID: 1065188979

View in Genome Browser
Species Human (GRCh38)
Location 10:23193492-23193514
Sequence ACGTTGACCGCGGCTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 14}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065188979 Original CRISPR ACGTTGACCGCGGCTCTCAA GGG Intronic
907327802 1:53652282-53652304 GAGTTGGCCGCGGCTCTCAGTGG + Intronic
915646866 1:157278804-157278826 AATTAGACCGTGGCTCTCAATGG - Intergenic
1065188979 10:23193492-23193514 ACGTTGACCGCGGCTCTCAAGGG + Intronic
1092472777 12:8793856-8793878 ACGTTTACCCCGGCTTTTAAAGG - Intergenic
1094117753 12:26936217-26936239 AGTTTGACAGCAGCTCTCAATGG + Intronic
1121435138 14:93914266-93914288 ATGTAGACCGCATCTCTCAATGG - Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1127851969 15:62921166-62921188 AAGTTGACAGCATCTCTCAAGGG - Intergenic
1157248042 18:46071271-46071293 AAGTTGACCGCAGCTGCCAAGGG - Intronic
1160452511 18:78974754-78974776 ACGCTGACCGCGGCTCCTCATGG + Intergenic
926382995 2:12309792-12309814 TCGTTGACCAAGGCTGTCAATGG + Intergenic
944129767 2:196335007-196335029 ACATTGACTGTAGCTCTCAATGG + Intronic
951911226 3:27752670-27752692 ACGTTGTACTGGGCTCTCAACGG - Intergenic
1199617803 X:149671645-149671667 ACCTTGTCCTCGTCTCTCAATGG + Intergenic
1199624839 X:149731604-149731626 ACCTTGTCCTCGTCTCTCAATGG - Intergenic